Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: binomicalabs.org/ SpikeF - AGGAATTTTTATGAACCACAAATCA MembraneR - CGGTGATCCAATTTATTCTGTAAAC NucleoF - AAATGAAAGATCTCAGTCCAAGATG NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT

@sadface7457

3 жыл бұрын

when is the next micro fluidic video ♡

@wolf359loki

3 жыл бұрын

Can you link to the Antibody test you used?

@rougenaxela

3 жыл бұрын

It's nifty taking those little primer sequences, doing the reverse complement, and putting it into a BLAST search, and seeing only SARS-CoV-2 come back in the results.

@Ahnahtan0

3 жыл бұрын

Very useful and informative! Valuable insight on this be-tweaked-st microbe toward its management.

@vitezhrabri4054

3 жыл бұрын

Hi so my question is the is a math solution how to do any kind of testing more efficiently, so is it possible to mix 4 or more samples together so it triggers if only one of them is positive?

Luckily I've managed to avoid getting it so far by hiding out here in the deep forests

@thethoughtemporium

3 жыл бұрын

Username checks out

@tonk8735

3 жыл бұрын

Second time I've seen u

@dismissing

3 жыл бұрын

@@tonk8735 are you saying you've spotted big foot twice?

@thorvaldspear

3 жыл бұрын

LOL

@tyrstone3539

3 жыл бұрын

Dude I see you everywhere

i should have watched this video before i tried

@XavierXonora

3 жыл бұрын

Nobody will know, it's fine

@boldey

3 жыл бұрын

wooo i like your vids woo

@t.lacey17

3 жыл бұрын

Oof

@bazzasoutdoorsandhunting1122

3 жыл бұрын

Yes! 😂😂😂

@blury6445

3 жыл бұрын

Eh u shoud survive if u didnt die yet \○/

I love how he casually use peas as coolant for his biological raw materials.

@MudakTheMultiplier

3 жыл бұрын

They're reusable!

@supernoodles908

3 жыл бұрын

@@MudakTheMultiplier and biodegradable

@spokehedz

3 жыл бұрын

@@supernoodles908 also great for when you bang your head on the fume hood...

@superdupergrover9857

3 жыл бұрын

There's also a pea shortage. No joke, the demand for peas from the fake burger industry has caused a shortage.

@superdupergrover9857

3 жыл бұрын

@@RoboticusMusic They can contaminate those vegan burgers all they want. Campbell's stopped production of their split pea soup (my favorite) because of the pea shortage.

Im 26 and had covid. I had symptoms for about 16 days. It felt like a moderate cold but with severe soreness and pain in my joints, especially my legs. I have moderate asthma and my breathing was easily controlled with my inhaler. I’m also a microbiologist so this whole pandemic has been extremely interesting. This is a great video.

Meow Ludo Disco Gamma Meow Meow has to be the most cyberpunk name I've heard, at least for a real-life person

@MemesnShet

3 жыл бұрын

I’ve read the “Gamma” as Grandma at first lmao

@pineapplesareyummy6352

3 жыл бұрын

I had to type that name into Google. That's his real name. He even ran for political office in Australia under the 'Science Party' and is a geneticist and entrepreneur. He is a serious guy with an unusual name.

@caca95cb

3 жыл бұрын

Dude he's totally related to Catra Applesauce Meow Meow from She-Ra

@Suninrags

3 жыл бұрын

@@pineapplesareyummy6352 did he change his name? I would assume he did

@waterunderthebridge7950

3 жыл бұрын

Neon Red kill Yup, apparently he made a funny name list with his friends and picked one he liked to change his name to

PCR= Pipette, Cry, Repeat. Never change! 😂😂

@Queekusme

3 жыл бұрын

This needs to be a new T-shirt design

@DrakkarCalethiel

3 жыл бұрын

@@Queekusme Hahaha, thus needs to happen! Shirt design on back: PCR Pipette (pipette logo) Cry 😭 Repeat (uno reverse card) I would get one like this. :D

@thethoughtemporium

3 жыл бұрын

Already working on it. Will have it out soon

@justalapwing

3 жыл бұрын

I'd buy it

@MultiPss

3 жыл бұрын

@@thethoughtemporium I need it

*L* (oop mediated isothermal) *AMP* (lification), I assume.

@GasparLewis

3 жыл бұрын

Either that or another language, like "SI" for SI units.

@SquaredSmith

3 жыл бұрын

Nah it's that thing on your bedside table what shines light. It can detect the virus through... uhhh... science magic

@jrblast

3 жыл бұрын

@@GasparLewis Or UTC where the English and French couldn't agree so they decided on an order that's wrong in both languages.

@EnriqueGonzalez-pw7xe

3 жыл бұрын

Or maybe it just was developed by moths, who knows?

@grn1

3 жыл бұрын

Just paused the video to comment this.

Anybody knows similiar channels about biology and chemistry? I only know this, and Nilered, and these topics are really interesting

@soumyadipbiswas9074

3 жыл бұрын

NielBlue

@soroushmirghasemi623

3 жыл бұрын

Marcin Zdunek I’m more familiar with chemistry channels, there are channels like explosion & fire, nerdrage, nighthawk in light, if you are interested in lasers styropyro has some great content and does some chemistry at times as well, of and applied science does great stuff too.

@polymorphicprocrastination5345

3 жыл бұрын

@@soumyadipbiswas9074 Applied Science

@notmynameanymore941

3 жыл бұрын

ElementalMaker is a dude who does a lil bit of everything, from artificial rubies to sugar rocket builds, plus he is a pretty funny dude; reminds me of a pipeline worker but smarter /s

@domokospiller8306

3 жыл бұрын

Explosion & Fire

Great video but I kind of laughed at the end. Putting a "listen to the scientist" spiel at the end of a 40 minute technical video on covid testing is the definition of preaching to the choir.

@KnakuanaRka

2 жыл бұрын

Yeah, the sorts of people who would need to learn that aren’t going to watch a video like this.

@drkastenbrot

2 жыл бұрын

@@KnakuanaRka They definitely watch videos like this, skipping through it to find bits that support their narrative and pull them out of context. Too bad this video doesnt say anything easily pulled out of context.

@KnakuanaRka

2 жыл бұрын

@@drkastenbrot Wish more videos could be like this one in that way.

it is INSANE how far you have come from the first videos I saw (the radio telescope/"wifi camera" adventures). the quality of science, recording, narrating, and overall production has jumped vastly; the scale and capability of your lap and tools have expanded as well; and perhaps most importantly, your passion for science and earnest pursuit of spreading knowledge has never yielded. Keep up the good work, keep yourself safe, and don't forget to take breaks sometimes so you don't burn yourself out!

Meow-Ludo Disco Gamma Meow-Meow is such an amazing name. Looking him up, I learned that he got in trouble for implanting his public transport card chip into his hand and was fined and summoned to court for traveling without a valid ticket (the judge dropped the case). Sounds like an interesting friend :-)

15:03 Ah yes, the most used refrigerant agent in biolabs : frozen peas! :D

I clicked as soon as I saw the patreon notification. Fantastic job on the animations. I can tell you really put your blood sweat and tears into this project. (sometimes literally) I also really appreciate that you didn't pull any punches for anti-maskers and conspiracy theorists. It's a bummer bad primers caused you so much trouble but I think the final product is some of your best work. I'm pretty hyped for the upcoming spider silk video. Keep up the good work Justin!

as a scientist like yourself, do you ever question the origins of COVID? do you think that there is anything you find uncertain or questionable about the virus?

As a healthcare professional I enjoyed your brief but scientific comprehension very much, to say it clear I love Your video! Thank you very much. (Of course I recommended it to many nerdy friends!) But I've been a bit suspicious with the Immunglobulines: As far as I know IgA (which is not present in your diagrams) is the only dimer (in humans), and IgD, which you present as a dimer is a monomer like IgE and IgG, too. Correct me if I am wrong!

@thethoughtemporium

3 жыл бұрын

You're correct, that was my mistake. Good catch! That was meant to be IgA. Must've gotten it confused in my notes at some point

@Spree1775

3 жыл бұрын

@@thethoughtemporium I appreciate your integrity

People are so caught up with deaths that they don't consider what happens to the survivors after - no matter if the illness was severe or mild. I had a 'mild' case, and I still have abdominal discomfort, occasional shortness of breath, and fatigue. Symptoms started on july 14

@thethoughtemporium

3 жыл бұрын

I mention this near the end

@socialamoeba6455

3 жыл бұрын

@@savage101. Good for you, sadly that is not the case for many.

@RBuckminsterFuller

3 жыл бұрын

"Long-haulers" aren't unique to covid. A lot of people who are diagnosed with CFS/FM (chronic fatigue syndrome, fibromyalgia) likely started out with infections.

You can use aquarium gravel instead of frozen peas! Can even use it to flash freeze stuff if you have access to a -80°C freezer. Keep up the good work! Your videos are interesting to watch even for us who work in labs all day long.

@thijewissema6412

3 жыл бұрын

aqua-rium gra-vel, okay noted, anything else? (to flash freeze throw some liquid nitrogen over it)

@ayatotakema1194

2 жыл бұрын

im guessing it has a higher energy desity right?

great video, enough over my head to make me realize how complicated it all really is

I love the frozen peas used as cooling agent :DDD

"Build a neat and better mask" *becomes daftpunk*

Wow, I've used TLC a lot at the medicinal chemistry lab to monitor chemical reactions. Those anti-body tests are like ultra overdrive TLC, it's awesome

at about 31:00 you state that people with past infections don't PCR test positive - actually, a surprising amount of people test positive weeks after a passed infection, due to "genetic garbage" still hanging around. These patients are, according to WHO standards, not considered infectious patients anymore. Do you know what this "genetic garbage" actually is? How long can naked pieces of RNA just hang out on mucous membranes?

@selkywaters

3 жыл бұрын

I know a guy that kept testing positive over and over. Finally somebody told him to rinse his sinuses out with saline. He did it three times a day for 8 days and finally tested negative.

@gabrielcohen1538

3 жыл бұрын

I thought such garbage was automatically kind of broken down but maybe it only applies to waste products from the cell and not from outside

@thijewissema6412

3 жыл бұрын

RNA is officially a proteïne so it can take a long time for it to break down under the temp it was meant to be in. (sorry i dont have a concrete number)

@Spree1775

3 жыл бұрын

@@thijewissema6412 RNA RUBBISH..as a Physicist it's obsolete rubbish.

"We live in a cyberpunk dystopia" Video liked.

@moncza1866

2 жыл бұрын

I can't find it but I want to

21:25 the googly eyes make your results more accurate.

@thijewissema6412

3 жыл бұрын

didn't notice that before, thx.

And who knew, almost two years later and, well, we're still dealing with this crap. At least we've got some legit treatments now (you know, with actual scientific evidence in support of them) and a few vaccines. Though, despite getting the initial course and the first booster shot, I just recently got Covid myself (for anyone wondering, 0/10, would not recommend). I'm fine now, but it still sucked for about a week. And before you ask, I'm only in my 20s. Though, I at least don't seem to have any long term effects from it...one of my coworkers that got it really early on, relatively speaking at least (I believe it was in about November 2020) and she still can't smell or taste stuff. Which, I couldn't even imagine going through life like that. Edit: Oh yeah, and even still, +1 on the wear a mask part from a healthcare professional here (I work in a hospital lab). They really can make a difference. Although, I'll also say that while the cleaning EVERYTHING before bringing it into your house was solid advice at the time this video went out, turns out, SARS-CoV-2 doesn't spread that great on surfaces, so that isn't as necessary as originally thought. Still not bad advice in general, just not a major factor in terms of Covid-19 spread. Edit 2: oh yeah, and another thing, that is only relevant now that it's been a while since the video came out...The false negatives are far less common nowadays. They absolutely were a huge issue early on (i.e. back when the video was posted), but nowadays the tests are quite reliable, even for the newer variants. Edit 3: Just one more thing I wanted to add regarding PCRs...if you've never been around a hospital lab style PCR, the thing I think that'll stick out the most is they are loud. Like, really, really loud. At least, the ones we use are absurdly loud. It's reminiscent of what a jet engine sounds like from inside the plane. So not loud enough to require earplugs, but loud enough that it's very clear something is happening. Of course, the PCRs at the hospital are more than just the block that heats and cools to specific temperatures. I mean, yeah, it has that part, but it also does all the measurements and detection internally. No gel electrophoresis or additional manipulation of the sample. It's literally just mix the UTM from the swab with the reagents, load, and await results. So it's possible the PCR like described in the video isn't quite as noisy, but I'm far from an expert on the stuff lol. Oh, nice, he talks about the difference in the diagnostic PCRs vs the one he initially described. Should've just kept watching Edit 4: and now I suddenly know why some samples we've tested consistently come out with an "inconclusive" result. None of us were quite sure the reason behind it, and after watching the video, well, I still don't know the underlying mechanism but at least I know the problem. One of the two primers came up positive, the other negative (and the human gene control part worked). Thus, the machine would've given an inconclusive result, despite multiple tests on the same sample. We always just give up and ask the nurse to recollect after it comes up inconclusive twice, and 999/1000 that solves the problem. So I still couldn't say why the initial sample was problematic, but at least I know the reason the machine insisted on giving a result of inconclusive.

It makes me happy to know that there’s 80,000 other people out there who are actually interested in how things in the world work

@studioreep7449

3 жыл бұрын

And then there are THOSE dumbasses

@sababugs1125

3 жыл бұрын

@@studioreep7449 dumbases ? Dude calling them dumb is an insult to actually dumb people . You're giving those people way too much credit

"I hope this will be enough of a wakeup call" haha, god I wish.

@StormBurnX

3 жыл бұрын

the people watching these kinds of videos mostly are the people who already know it's bad. if there was a way to force this video's knowledge on everyone and force them to have a high enough IQ to comprehend it, then that would be a wakeup call. But no, the only brainwashing technology we have is 5G and coronavir- wait...

@LimabeanStudios

3 жыл бұрын

Yeah at this point everyone has already formed their opinions on this whole situation, and that usually only changes when someone who downplays covid loses a family member.

@Herr_Brechmann

3 жыл бұрын

@@StormBurnX The whole world is dying, ffs you guys

@eideticex

3 жыл бұрын

From what I have seen, I doubt the wakeup call will work either. I have seen plenty of people say "it'll all be over after the election" or similarly stupid nonsensical bullshit. All while having a friend or family member disappear to their home for a few weeks with COVID-19. They literally do not see or hear it happening right in front of them.

@TheComputadude

3 жыл бұрын

@@eideticex And you also have people like Herman Cain who die from it and tweet from the grave about how it wasn't that bad.

I can't believe I sat through this looong video about a field of science that I knew nothing about and actually learned something. This is some high-quality content.

@averagecornenjoyer6348

3 жыл бұрын

watch more of his videos, this guy is awesome

39:12 I was almost as impressed by the fact that the auto-subtitles transcribed "Cheeto von Gropensnatcher" correctly as by the quality of the video ^^

Please be careful about recommending ubiquitous testing. At very low prevalence levels, (sub the "prevalence threshold" for the test), the precision (PPV) drops rapidly. In places like NYC, where the prevalence is 1% or less, a large majority of positives end up being false. Until tests get to ultra-high >99.9% specificity, the prevalence threshold, given their sensitivity, is >3%.

@ukaszMarianszki

3 жыл бұрын

Getting a false positive is way less of an issue than missing a case, because the worst that can happen to you in that case is getting isolated, which you should be doing anyway

@GigsVT

3 жыл бұрын

@@ukaszMarianszki pretending that isolation has no cost is ridiculous

Great vid and great link collection in the description. Thank you.

Okay if Meow's parents named him that just imagine the bullying he went through.

@thethoughtemporium

3 жыл бұрын

He named himself that later in life.

@Ryan6.022

3 жыл бұрын

@@thethoughtemporium then he is super awesome

@nefariousyawn

3 жыл бұрын

@@Ryan6.022 I'm imagining a hyper intelligent grad student that went on a psychedelic vision quest of a lifetime. From this he gained a sense of humor, a sense of purpose, and superhuman powers of chill. I've had friends attempt to rename themselves after a heavy trip, and none of them were this cool.

@nahometesfay1112

3 жыл бұрын

@@thethoughtemporium Is his first name Meow and his last name Meow Meow? Does his name follow the first, middle, last form?

@davidmaisel8062

3 жыл бұрын

@@thethoughtemporium He just got more awesome!

Actually kind of blown away that you just exploit the RNAs goal to self replicate but do it in a lab and look for the result that it’s duplicated exponentially 🤯

@wesleymays1931

3 жыл бұрын

This is called "tricking the enemy"

@masonbarber871

3 жыл бұрын

@@wesleymays1931 So I guess we are testing for covid by tricking, backstabbing, and quite possibly bamboozling a virus. I love science.

so interesting I've watched it twice - good job

Awesomely informative! Thanks!

at 32:08 : polyclonal antibodies are distinct antibodies and not one that binds to many epitopes.

Why are there so many dislikes wtf

they shortened the loop mediated etc part to L and then used Amp for amplification. It's actually a pretty clever solution to give it a memorable name.

I am currently a high school student and my school district decided from the start to not open up the schools in that district. This does suck as there is a major social aspect to school, but I`m becoming more grateful to the fact that they kept it to online school from the start as all of the other districts in the area are closing schools and are vastly underprepared for online school.

This is a really detailed and amazing video! This information is important for the public to know, and I'm glad you're putting it out there. I hope my videos become as well-explained as yours one day haha :D

@thijewissema6412

3 жыл бұрын

with hard work and dedication you will one day.

Where I live, we’ve only had 27 cases (all recovered with no deaths nor community spread) and it’s been almost two months without a case. Hearing about what’s happening in the rest of the world seems fake, though I know that it is, unfortunately, true. All we did was follow our public health guidelines. ITS NOT THAT HARD!

@hammerth1421

3 жыл бұрын

My county has 15 imported cases (that were detected) through people returning from their holidays. School starts again next week. This is gonna be great.

Thank you for this video!

This dude's content is like the answer to my questions

I think it's interesting that at the beginning of your video you basically say that no political talk should be made in the comments, then you go on to make a lot of political statements for 5 minutes at the end of your video. That being said, it's a great video, but I lost the ability to use this in my classroom when you went on a political rant at the end. I love your videos, and I hope you'll make one about T-Cell immunity because it gets old explaining it to people who don't understand even the most basic parts of biology. Keep up the good work!

@WarningStrangerDanger

Жыл бұрын

It is simply outdated at this point. The downside to such long videos is that you can't select for the information that withstood the test of time and set aside the parts that aged poorly.

Awesome work! Thanks!

Nice, watching this while waiting for my test results. Will share the result and the test type when I find out, likely on saturday.

The term Coronavirus comes from Spanish, corona is crown in Spanish, now does that crown on a bottle of corona beer make sense.

Stellar video, Justin. Good humor, too. I’m going to have to watch it a couple more times and check out those papers.

That moment when you realize how much more science you need to learn... and the moment persists throughout the video. Sadly, my rudimentary understanding of bioscience may have dampened the intended response to this information - but I am now taking this issue more seriously. Thank you for this extended content, good sir.

@aBradApple

3 жыл бұрын

I have downloaded this video for future reference and dissemination.

@karak962

2 жыл бұрын

❤️ it’s great you took time to learn! i don’t know much either even though i love this stuff.

Hey where did you get that antibody test that you did in the video? I’m immune compromised and I do monthly igg replacement therapy, and I would be interested to test myself to see if any covid antibodies have worked their way into my igg infusions. I would want so self administer because then I could avoid labs and potential exposure.

LAMP I would assume is them using the “L” from loop and the “AMP” from amplification but it is a far stretch lol

this was a nice summary of what I needed to know and what is currently known

I work on software for an automated processing platform (qPCR and microarray), and it is nice to understand a bit better about how the primers and fluorescence markers work. The only real understanding I had to have was: it grows a lot and glows in this specific way if you do "biology stuff" to it. But it is nice to know what the colleagues are actually up to.

@karak962

2 жыл бұрын

that’s awesome!!!!!!

So very well done, thank you. I have a much better understanding of qPCR results

I have been looking for something like this for a long time, thanks. The only thing I disliked was the ”Don't be alarmed. But be alarmed, this is the new normal”-bit. In Finland we have a lot of new cases now, but zero people in intensive care for a month, and a just handful getting hospital treatment, even as very few bother with the masks. Is this because hand washing, distancing and protection of risk groups have been effective, or has something happened to the virus itself during summer? It is mutating, after all. I think the jury is still out on near future developments.

How is there almost a 7:1 like to dislike ratio on this video? You would think the people subscribed to this channel would be the sort to know better than to subscribe to baseless conspiracies. Not to mention you clearly spent a lot of time thoroughly researching this and cited sources that they could check and see are reputable.

@Basement-Science

3 жыл бұрын

Probably because a lot of CovIdiots get it recommended who are not subscribers.

@C2H5OHist

3 жыл бұрын

I disliked because I don't like politics in my scientific entertainment

@microwave221

3 жыл бұрын

People are eternally disappointing, and the number of comments alleging that the whole thing is a hoax should explain where it's all coming from. A vocal minority, but thankfully a minority none the less

@narpassword3546

3 жыл бұрын

In this day, where the right are blatant anti-intellectuals who dismiss any science that they don't "agree" with, science is inherently political

@Yildun28

3 жыл бұрын

@@C2H5OHist Same here. The political digs undermine the credibility of the video. If I can spot fallacious reasoning/data on things I am well informed about, it makes me question whether I can trust him on things I am not and came to the video to learn more.

thank you for this vid......Much love from the Netherlands...

Thank you for this

Instead of disliking the video, read the citation in the description and check the sources, and then compare that to the citation of sources that says otherwise, if said citation exists at all

@XavierXonora

3 жыл бұрын

You can't expect people to do work to debunk their own fallacies. It's a psychological disease

It is still around today even with the vaccine

@Cerealbox352

Жыл бұрын

Duh yes it is same reason the bubonic plague still exists

@olivercharles2930

11 ай бұрын

Uh, no shit. There are very few diseases that are totally eradicated. Measles still exists. Hell even the plague still exists, and that one is positively ancient.

@the thought emporium off topic question.. Since your lactose intolerance modification wore off, it has me wondering. If you were to use a custom retrovirus to induce CIPA in yourself, would that also ware off?

i currently have covid and this video was very enlightening. thank you :)

Hi Justin, I’ve been binging these videos since I found them. I’m very interested in this line of work but am a physics junior already, with plans for a masters in electrical engineering, so my time to branch into biology while in undergrad is limited. Do you have any suggestions on classes to take that would set me up well to combine engineering, physics, coding, and bio? Or suggestions on extracurriculars or diy stepping stones? Thanks to you I’m looking into a magnet implant, depending on my future specialization, this could be super useful.

@thethoughtemporium

3 жыл бұрын

The easiest way to get started is probably on your own, but there's nothing stopping you from taking an intro to bio or biochem class. Though fair warning, they'll bombard you with an enormous amount of information. But if you just want to learn on your own, crash course has a bunch of great series on the topic. I also suggest the book "the manga guide to molecular biology". It's cute, well written, and covers a ton of stuff. Beyond that, look at places like amino.bio, biobits or carolina biological and get yourself one of their fantastic kits. You'll get some hands experience and get to see how some of this stuff works for yourself

@alima9353

3 жыл бұрын

What a coincidence I’m studying molecular biology at university but maybe want to stem out into physics. Maybe biophysics? There are similarities between biology and physics which may be surprising like molecular motors. Anyway good luck with your journey !

@drkastenbrot

2 жыл бұрын

I am doing EE at a uni and biochemistry and whatever else interests me on my own terms. Doing any biology at uni is very, very harsh.

I am so glad you made this video! You are educating so many people about such a serious problem and it is honestly people like you that are keeping this world alive. Keep up the amazing work man :)

This is unique content on youtube, i have not found anything similiar to it. I love your channel, altough i dont understand anything. Guess i will stick with my area of expertise. Great work tho.

I wish this was 2 hours long in a way, but very great info here. and good final points, Really agree with your summery

It's really funny watching this video after all the stuff came out from the CDC.

@AnalogDude_

2 жыл бұрын

he watched to much t.v.

@WarningStrangerDanger

Жыл бұрын

Specifically the masks bit. Masks were not very effective. 6 feet was an arbitrary decision. Totally avoiding people was the safest option.

@jaxsonsorenson3659

Жыл бұрын

@@WarningStrangerDanger Yes, 100%, but also the actual virus for everyone who isn't the age of 60 or has severe immune compromises, it has a 99.9% survival rate.

Seeing that ending now... Oh boy, I sure love how we all got together and tried to solve every important problem we had! In any case, thanks for your videos man. I am not in the biomedical field but I love watching your videos and hopefully learning something useful.

@afshinafshin6408

2 жыл бұрын

why not geting in it ?

I love how I dropped out of school and the first GED test I take I passed with pretty much just 7th grade biology. And here I am still interested in these topics. Then again maths and science were my middle school strong suits.

Amazingly well presented and well explained. Thank you for your hard work Justin!

Lol, i am proud of myself that i made it till the end of the video. If our biology classes were like this, they'd be more interesting to attend.

@averagecornenjoyer6348

3 жыл бұрын

hentai ousama

@xenonram

3 жыл бұрын

If teachers could spend DAYS/weeks making a video about a single example of a single topic, that would be true, but then an undergrad degree would take about 2 decades to complete.

Isnt it Loop mediated isothermal AMPlication?

@Christian-os3kk

3 жыл бұрын

AMPlification*

Such an amazing and instructive video

Use the Respiratory Panel PCR test keeping within correct amp cycles and test for all those respiratory illnesses that vanished. Even better lets run a certain percentage of positive cases through cell culture and electonmicroscope identification.

Hum.. whats going on with the dislikes? Are bots auto-disliking covid related vídeos or something?

@Basement-Science

3 жыл бұрын

CovIDIOTs.

@WanderTheNomad

3 жыл бұрын

I don't consider the amount of dislikes high until it reaches 1000+.

man it is depressing to know that we used to think there was a chance wed do something about all this instead of just arbitrarily deciding it was over when it wasnt and refusing to do anything more

Great video! I have a friend who's working on lamp tests and while she tried diligently I feel I just now understood the major differences to the pcr tests. Thank you!

Amazingly Awesome content. Loved it

Mr Meow Meow seems like a pretty chill dude

@wesleymays1931

3 жыл бұрын

Implanted an Opal Card chip into his hand.

I’m not sure if I’m taking your final point the wrong way but I thought it was quite controversial. Yes this is a temporary “new normal” and it kind of is a new normal in the sense that once we get over this virus we will react like Asian populations have done for decades aka wear a mask if you are sick. I’m not sure if you were implying that you’ll have to wear a mask for the rest of our lives, constantly? Correct me if I’m wrong on that one. We will get back to normal without the constant need to wear masks. We will socialise in bars pubs and clubs again. We will go on holiday again. All without social distancing and masks. It should be a selective thing. We need to encounter disease for our bodies to protect against them (I won’t patronise you because you’re well qualified for this OBVIOUSLY🤣). Masks won’t be weird anymore, people will wear them when they deem fit (after this pandemic) and people will be more open minded about wearing them. I think the problem with this virus was the initial uptake of masks either because they felt embarrassed or they thought it was stupid which is a valid reason because yes it is weird, but now it’s a whole new kettle of Fish people will have a much much faster reaction to future pandemics (if that’s what you mean by new normal). We can’t and won’t constantly wear masks after this virus has been contained and defeated, it’s just not socially viable, we are very social species and masks hinder our ability to connect with people. I’ve not been outside in weeks and I’ve only been outside 5 times in the past 3 months and that’s terrible because I’m feeling a little depressed. I’m doing my chemistry lectures from my bed and I’d say I easily spend 23.5 hours in bed which is utterly dreadful. At the start of the pandemic I’d go on 125km cycles twice a week for about 6 months going 25km walks but now I’ve been broken I guess. I’m in the Royal Air Force and I’ve have not flown in 11 months I’ve missed hundreds of hours of flying and activities I’m so sad. What I’m trying to say is we cannot and will not continue living like this and we will go back to a full normal with added reactions. This is all about gaining a valid reaction to this so we are prepared in the future, whether that’s from governmental spending in science, social norms in the sense of masks and social distancing, we will be more prepared for future iterations of this generation killer.

Very informative. I wasn't aware of the LAMP testing but it's very interesting. This video explains why testing is slow in some countries.

I run qPCR tests for a fungal pathogen regularly and some primers do just have a bit of background fluorescence (extra junk), you can apply a correction to the output curves to account for that though I want a pipetting robot so bad, I use 384 well plates and I've messed up so many samples cos I've lost track of which well I'm at

Thanks for this great video - really informative to people with sufficient knowledge. As I studied Biotechnology, we did PCR in the University lab, and we all experienced similar problems as the ones shown here, although I never in clinical setting. Based on experience and stability of RNA, it makes me wonder: 1. Can we quantify the odds of a true positive? I guess it's 3 divided by the total number of things, which may go wrong in the process. 2. For the second type of RNA test, I will do some reading - I wonder how lowering pH impacts the sample in the process and why the false negatives are less likely than more positive. 3. For the antibody test, I wonder if all SARS-Cov-2 proteins are being tested for, and whether an immune response via CD8 cytotoxic T-cells which detect infection via the MHC receptors, can be detected? 4. Also, if antibodies were produced in response for another Coronavirus, which also bind to SARS-cov-2 proteins, how we avoid the false positive? 5. It's not the first time I hear that coronavirus mutation -a simple RNA virus - it mutates more slowly than say HIV virus, and I'm struggling to understand the reason. My understanding is virulence and spread of disease increases the mutation chances and HIV is transmitted by means of sex or blood transfusion. Anyone have a good source of reading or simple explanation why mutation would be slower here? Thanks and again - great video - might be a bit sceptical on test accuracy and impact of the new normal on the demographic crisis - but definatelf quite interesting and a deeper dive details may interest folks like me!

@jaboris2536

2 жыл бұрын

Virology is a lie that’s why

@cjbrenner13

2 жыл бұрын

All of that logic and he couldnt reply. It would undermine his and their entire theoretical superiority complex over a 97% +/- survivable virus. Thank you for sharing this beautiful knowledge.

Nice i was looking for an explenation of how testing works for a while!

Thank you for this incredibly informative video. Keep at it, your content is truly next-level

Amazing video man!

"RT" in "RT-PCR" stands for Reverse Transcription (or Transcriptase), not Real-Time. qPCR is quantitative PCR (real-time), and "Real Time RT-PCR", or "rRT-PCR" or even "RT-qPCR" is real-time RT-PCR. 😊

@hammerth1421

3 жыл бұрын

I'd like it to be that way, but RT-PCR was actually used as a name for qPCR for a while and some stubborn research groups are still doing it like that.

Ah the science side of this I love your videos, they're informative and go into a satisfying depth of the topics

Should have stuck to that bio chemistry classes in college. I surprisingly enjoyed this video

this video is awesome thanks so much!

I love your videos and learn so much from them, but i have a confession to make when I'm having a hard time sleeping ill play one of your videos and it knocks me right out.

"each tan you open gives you a heart" oh no. I can get like 600 hearts a day just from forgetting how to spell

Do labs ever do batch testing? Like, combining samples from 10 patients in one test, and retesting positives?

Ok gonna save this video... For night time sleep... (was watching during day... cause strong sleepiness)

thank you, no other science channel is explaining covid detection carefully and detailed like you do.

Most interesting part for me was when you were talking about building your own mask and I saw you guitar in the background! What do you like to play??

@SidneyCritic

3 жыл бұрын

Thunderstruck and Hotline Bling - lol - TheDooo joke

Finally a comprehensive video on this subject. Love your content in general, but this particular video needs to reach a wider audience. I hope that the algorithm picks this up.

Thank you for your time!