HOGS CRYING OVER TRUMP INDICTMENT

Conservative hogs react to the news that Donald Trump was indicted and was arraigned in New York over business fraud casein this episode of HOGWATCH
Live everyday at / hasanabi
Edited by: / ddohasanabi
Other Links
TikTok: / hasandpiker
Twitter: / hasanthehun
Instagram: / hasandpiker
Second Channel: / @hasanyoutube
Gaming channel - / @hasanabigaming

Пікірлер: 1 300

  • @yellowbutterfly6796
    @yellowbutterfly6796 Жыл бұрын

    republicans: but if trump is held accountable then any president can be held accountable! everyone else: yes! do that! we fully support that!

  • @whatdatdogdo

    @whatdatdogdo

    Жыл бұрын

    I wouldn't say the liberals are advocating for penalizing previous presidents given their record. But I agree all American presidents should be tried at the hague

  • @sirdrchefwangiii1841

    @sirdrchefwangiii1841

    Жыл бұрын

    Thats the point. It wont ever happen which begs the question why do the elites want trump out the way?

  • @rio5725

    @rio5725

    Жыл бұрын

    @@sirdrchefwangiii1841 dude, the elite IS trump and his funders lmfao

  • @lumisussy

    @lumisussy

    Жыл бұрын

    @@sirdrchefwangiii1841 what makes trump different from the other "elites"?

  • @yellowbutterfly6796

    @yellowbutterfly6796

    Жыл бұрын

    @@sirdrchefwangiii1841 ikr, you cant even pretend to win and tell your followers to storm the capital when you lose an election anymore in this country, us republicans are uniquely persecuted for no good reason

  • @natacee566
    @natacee566 Жыл бұрын

    My friend was a trans sex worker, and she said 90% of her clients were literally these guys.

  • @PartnershipsForYou

    @PartnershipsForYou

    Жыл бұрын

    Tell that person to be careful: righties are mentally unstable and could snap at any moment

  • @MajorasWrath1

    @MajorasWrath1

    Жыл бұрын

    I salute her for her service. She's been through more unpleasantness than any troop or cop. Genuinely. 🫡

  • @MultiKatieBee

    @MultiKatieBee

    Жыл бұрын

    I believe it. Lots of closeted homosexuality in the world of hogs.

  • @fluidthought42

    @fluidthought42

    Жыл бұрын

    ​@@MultiKatieBee I wouldn't call it homosexuality, but at the same time chasers do be weird about girldick

  • @Matt-ru5rw

    @Matt-ru5rw

    Жыл бұрын

    I mean if they aren't touching children they want to be banged by trans women.

  • @TheEclecticDyslexic
    @TheEclecticDyslexic Жыл бұрын

    "I thought stormy daniels was a senator" This is definitely the guy we should be getting our political opinions from, he clearly has his finger on the pulse

  • @chucku00

    @chucku00

    Жыл бұрын

    Well, they're the same people who elected Empty G, so there's some logic in his delusion.

  • @Mumiah862

    @Mumiah862

    Жыл бұрын

    @@chucku00 what is empty g

  • @chucku00

    @chucku00

    Жыл бұрын

    @@Mumiah862 Margarine Tumour Gene

  • @Student0Toucher

    @Student0Toucher

    Жыл бұрын

    Its funny seeing libs happy that this indictment clears the way for Ron DeSantis a actual by the book smart conservative that can actually win and really change stuff in a smart way that democrats wont be able to do anything about

  • @marinemanaphy101

    @marinemanaphy101

    Жыл бұрын

    Kinda insane that somebody who’s been following Trump closely didn’t know that tbh. Like, *every* article and news story about Stormy Daniels goes out of its way to call her a porn star.

  • @sanderness
    @sanderness Жыл бұрын

    god I LOVE the ambulance conspiracy theory. it has just the right amount of crazy

  • @das_it_mane

    @das_it_mane

    Жыл бұрын

    Every time there's an ambulance behind me in traffic, I automatically become president.

  • @DRACOCHIEF

    @DRACOCHIEF

    Жыл бұрын

    Every time an ambulance passes, the president is in there. 😔

  • @whoreshoe

    @whoreshoe

    Жыл бұрын

    all ambulances have at least one "alien disguised as a president" occupant

  • @bazzfromthebackground3696

    @bazzfromthebackground3696

    Жыл бұрын

    Ambulance drivers are all actors.

  • @ratboy4169

    @ratboy4169

    Жыл бұрын

    Only the best for trump, only the most loyal brain dead followers. Are they tired of winning yet?

  • @itsd0nk
    @itsd0nk Жыл бұрын

    “Wake up people!” “Woke people are the devil!” “But you all better wake the fuck up!”

  • @xXRickTrolledXx

    @xXRickTrolledXx

    Жыл бұрын

    Double speak literally at its finest

  • @elkosins1686
    @elkosins1686 Жыл бұрын

    “You can’t punish a former president think of the optics! This is communism!” These are the same people who say Biden should go to jail cuz his sons laptop has pics of him doing coke

  • @mpjstuff

    @mpjstuff

    Жыл бұрын

    "This is communism" -- well, sure. Communism distributes power to the people, and they would be able to hold leaders accountable. But have we have communism or did the world experience "lot's of farming with big words and a totalitarian government"?

  • @desolationlovesIHOP
    @desolationlovesIHOP Жыл бұрын

    Divorce is such a disease guys please support your local divorced dad

  • @Goatchild90

    @Goatchild90

    Жыл бұрын

    lmao

  • @PartnershipsForYou

    @PartnershipsForYou

    Жыл бұрын

    As a guy with a divorced dad I can relate . Marriage is a failed structure

  • @pinkcatacombs

    @pinkcatacombs

    Жыл бұрын

    All of these men are proof that every divorce proceeding should have court mandated therapy afterwards

  • @futuristicgirl14

    @futuristicgirl14

    Жыл бұрын

    my dad 👁️👄👁️

  • @IanMcGarrett

    @IanMcGarrett

    Жыл бұрын

    These guys are just divorced from reality.

  • @PhoenixFireZero
    @PhoenixFireZero Жыл бұрын

    "go out like a warrior," says the sapient ball of cholesterol and regrets.

  • @Tearintime

    @Tearintime

    Жыл бұрын

    Fr, like feel free to go out. We’ll be happy to be rid of you

  • @noahboucher125

    @noahboucher125

    Жыл бұрын

    Theatre kid energy

  • @PhoenixFireZero

    @PhoenixFireZero

    Жыл бұрын

    @@noahboucher125 the most american tradition is to talk big shit and do nothing

  • @mpjstuff

    @mpjstuff

    Жыл бұрын

    @@noahboucher125 Yes, but a good method actor can get ripped and kick some butts! Jean Claude Van Damme -- theater kid. Sean Hannity -- no theater. I rest my case.

  • @matthewh.9523
    @matthewh.9523 Жыл бұрын

    50% of US adults read at a 6th grade level- 20% of US adults read at a 3rd grade level- and they are represented here.

  • @fmlAllthetime

    @fmlAllthetime

    Жыл бұрын

    Agreed... but I don't wonder if that's not common across literate people on the planet in general. Obviously 76% know it's somewhat political, and yet 60% still say fuck him ya know? So like, the majority ain't wrong here, even at their 6th grade reading level.

  • @SuperTonyony
    @SuperTonyony Жыл бұрын

    For any right-wingers out there: "Liberalism" means "individual rights, voting, property rights, and free enterprise". "Socialism" means "worker ownership and control of the means of production". "Communism" means "the abolition of class, money, and the state". Words have meanings. Look them up.

  • @pllpsy665

    @pllpsy665

    Жыл бұрын

    You expect them to understand 3 words? Very optimistic of you.

  • @Silvermoon424

    @Silvermoon424

    Жыл бұрын

    I wish this would have an effect on them but they'll continue to insist that all three words are the same thing. Which is "when the gubmint does something I don't like."

  • @lc360

    @lc360

    Жыл бұрын

    no communism is when trump sees the bare minimum consequences for his actions and socialism is when poor people can go see a doctor (this is bad)

  • @shanefoster2132

    @shanefoster2132

    Жыл бұрын

    You sound like one of those gawd dang liberal communists.

  • @zagorim7469

    @zagorim7469

    Жыл бұрын

    Now that's something only a liberal communist would say !

  • @t33nyplaysp0p
    @t33nyplaysp0p Жыл бұрын

    Grown ass men crying over a 70 year old, who doesn't even know them, getting indicted for financial fraud, while not getting put in cuffs, is absolutely amazing .

  • @bigjohnson7415

    @bigjohnson7415

    Жыл бұрын

    76 years old!

  • @mpjstuff

    @mpjstuff

    Жыл бұрын

    "He didn't even get his pillow fluffed or a chocolate on his pillow -- witch hunt!"

  • @t33nyplaysp0p

    @t33nyplaysp0p

    Жыл бұрын

    @@mpjstuff that part

  • @TRE45ON.is.Bat5hit.Crazy.U.S.G
    @TRE45ON.is.Bat5hit.Crazy.U.S.G Жыл бұрын

    Criminal Defendant Trump: "I wouldn't touch her with a 10 foot pole." Her: "And he didn't. He used a 3 inch one instead."

  • @SuperTonyony

    @SuperTonyony

    Жыл бұрын

    I see what you did there!

  • @uncomfortabletruth3831

    @uncomfortabletruth3831

    Жыл бұрын

    You stole that from Fallon or Kimmel .

  • @AskiatheGreat64

    @AskiatheGreat64

    Жыл бұрын

    BE BAPTIZED IN THE NAME OF JESUS CHRIST SO THAT YOUR SINS MAY BE WASH AWAY! REPENT FOR THE KINGDOM OF HEAVEN HAS COME NEAR!

  • @Opheliakami

    @Opheliakami

    Жыл бұрын

    ​@@uncomfortabletruth3831 no, Stormy herself.

  • @InaneBlatherPodcast

    @InaneBlatherPodcast

    Жыл бұрын

    @@AskiatheGreat64 take it outside, godboy

  • @FJK22
    @FJK22 Жыл бұрын

    “Wake the f*** up” he’s saying he’s woke

  • @mpjstuff

    @mpjstuff

    Жыл бұрын

    He's not THAT kind of woke. He's awake. Being woke means you were asleep and now you aren't. He's never been a fool and nobody can fool him because his facts don't care about your feelings. You think this doesn't make any sense? Well talk to the hand!

  • @Drwildy
    @Drwildy Жыл бұрын

    I miss hog talk. This shit needs an episode weekly

  • @arnoldfreeman2885

    @arnoldfreeman2885

    Жыл бұрын

    I mean you could just watch The Leftovers with Hasan and Ethan

  • @soyborne.bornmadeandundone1342

    @soyborne.bornmadeandundone1342

    Жыл бұрын

    This this this! Not just because it's fun but it's educational. DIVE DEEP into the minds of the mindless lol. I think it's good that folks know what kind of scum is out there. As Carlin always said... Life is about detecting stupid bs in order to then learn to avoid it lol.

  • @777L777E777

    @777L777E777

    Жыл бұрын

    ​@@arnoldfreeman2885 I don't like Ethan

  • @2guys1cliplol

    @2guys1cliplol

    Жыл бұрын

    That guy at 4:03 lived in Cuba till he was most likely 6 months old before his family moved to the US and then tells everyone the "horrors of cuba" 😂😂😂

  • @DarrienGlasser

    @DarrienGlasser

    Жыл бұрын

    @@arnoldfreeman2885 Leftovers doesn't happen weekly ... or does it? It feels like there's a month in-between episodes

  • @TheMosayat
    @TheMosayat Жыл бұрын

    "Imagine coming in to see your dad making these videos" "The reality is the kids aren't coming, this weekend" lmaoooo

  • @alexanderg.i1991
    @alexanderg.i1991 Жыл бұрын

    Wait people still believe trump is the acting president? So why do they hate the direction the country is going if they love trump so much and he’s acting president.

  • @celticcomradelad1850

    @celticcomradelad1850

    Жыл бұрын

    Because they're idiots that will say anything to save face. These are the same people that used to call Angela Murkle a Communist, you know the conservative Christian leader of Germany. Simply being pro EU and not being as bigoted as them was enough for them to label her as a communist, that's the point, it's easier for them to blame commies/liberals even when it's not commies/liberals

  • @t33nyplaysp0p

    @t33nyplaysp0p

    Жыл бұрын

    Don't try to reason with them lol

  • @erikvan9582

    @erikvan9582

    Жыл бұрын

    Logic isn't the strong suit of conservatives?

  • @IAmTheBugInsideYou

    @IAmTheBugInsideYou

    Жыл бұрын

    You're giving their bullshit way too much credence lol

  • @goldenwolfae

    @goldenwolfae

    Жыл бұрын

    that takes too much intelligence to think more than 5 seconds ahead. a goldfish has better reasoning than these people

  • @cjboyo
    @cjboyo Жыл бұрын

    Continually shocked my crazy ass uncle and his wife haven’t shown up in any of these hogwatch videos

  • @itsd0nk

    @itsd0nk

    Жыл бұрын

    You have a crazy trump Uncle who isn’t divorced? That’s a unicorn right there.

  • @MatataMcCleskey

    @MatataMcCleskey

    Жыл бұрын

    Soon, young grasshopper

  • @jaiadlakha212

    @jaiadlakha212

    Жыл бұрын

    @@itsd0nk cause his wife is probably a hog too lmao

  • @MrGared22

    @MrGared22

    Жыл бұрын

    Give it time, my friend Also, holy shit, he isn't divorced?

  • @carverjohnson2941

    @carverjohnson2941

    Жыл бұрын

    Same here, he actually used to be further left than my folks - but his wife is the conservative one.

  • @amy1160
    @amy1160 Жыл бұрын

    Where I work 2 old people were talking about how crazy the indictment was and that "this is not what our country stands for" lmao

  • @callofmetals24

    @callofmetals24

    Жыл бұрын

    Glad they won't be around for long

  • @jfk8540

    @jfk8540

    Жыл бұрын

    our country doesn’t stand for rich in powerful people being held accountable for their crimes, technically they’re right. but they couldn’t be further from right in the sentiment. they want one man to wield power without accountability, without the possibility of consequences. they believe he is infallible and above the law, they quite literally dwell in opposition to the core principles behind the foundation of american democracy and the republic. that is the most infuriating thing about them, they believe they’re these righteous crusaders defending american principles, when their ideology and reactionary beliefs are in direct opposition to the principles held by the founders of this country.

  • @dmoneyonair

    @dmoneyonair

    Жыл бұрын

    *our country stands for letting them get away with it*

  • @Katimashi

    @Katimashi

    Жыл бұрын

    Maga is American Taliban

  • @0bsmith0

    @0bsmith0

    Жыл бұрын

    So the country stands for complete dishonesty and criminal behavior? That's about right.

  • @alandewhirst7211
    @alandewhirst7211 Жыл бұрын

    As a proud pittsburgher, that dude is a disgrace to that pirate hat. Only the pirates get to embarrass Pittsburgh like that

  • @Pensnmusic

    @Pensnmusic

    Жыл бұрын

    Hear hear. We don't need another embarrassment representing us.

  • @hopelessromantic3786

    @hopelessromantic3786

    Жыл бұрын

    I don't know shit about sports but I really liked this joke.

  • @emofascist

    @emofascist

    Жыл бұрын

    How bout them pens lately?

  • @brandonself6287

    @brandonself6287

    Жыл бұрын

    Finally my people

  • @thegargoylecumeth7932

    @thegargoylecumeth7932

    Жыл бұрын

    Also from Pittsburgh, and agree

  • @Frolickingflounder
    @Frolickingflounder Жыл бұрын

    So glad Hasan is finally streaming hogwatch legacy

  • @Myst1cSoul

    @Myst1cSoul

    Жыл бұрын

    Damn it that was good

  • @thechief043

    @thechief043

    Жыл бұрын

    The sequel we needed but didn't deserve.

  • @soyborne.bornmadeandundone1342

    @soyborne.bornmadeandundone1342

    Жыл бұрын

    Enjoying a nazi terf wizard game that's about as good in terms of game design as any generic ubisoft trash? Eyeah.... Not a great look lol. How about no to that... Laughing at nazi lover dikheds who have no life on tik tok? Now that's what I'm phuckin talkin about! Actual fun happens here haha.

  • @rjv-rw2ef

    @rjv-rw2ef

    Жыл бұрын

    Libs gotta eat too

  • @SuperKiao

    @SuperKiao

    Жыл бұрын

    Such a hypocrite 😂😂😂😂😂

  • @Culled
    @Culled Жыл бұрын

    Imagine simping for someone like this holy shit. It’s their whole personality

  • @MultiKatieBee

    @MultiKatieBee

    Жыл бұрын

    And it's extra sick they are simping for Dumpster Trump!

  • @Badtown1988

    @Badtown1988

    Жыл бұрын

    And of all the people to simp for, they pick a dude who wouldn’t piss on them if they were on fire. Not only are they losers, but they’re the least perceptive people on the planet.

  • @rolloxra670

    @rolloxra670

    Жыл бұрын

    Fr 😂 I wouldn’t be surprised if a whole religion creates around Trump

  • @H56Nooc

    @H56Nooc

    Жыл бұрын

    ​@@rolloxra670 feels like it already has tbh

  • @rbustamante86

    @rbustamante86

    Жыл бұрын

    I never understood anyone being a fan of any politician at all. Why would you simp for anyone who got their job by going through a popularity contest.

  • @RustyWalker
    @RustyWalker Жыл бұрын

    He gets to have his time in court just like everyone else. Which part do they think is unfair?

  • @blackwatertv7018

    @blackwatertv7018

    Жыл бұрын

    They think him being held accountable is “unfair” that’s it. He’s above the law in their eyes.

  • @kalixaudnari309

    @kalixaudnari309

    Жыл бұрын

    ​@@blackwatertv7018 Rules for thee but not for me

  • @majortom4711

    @majortom4711

    Жыл бұрын

    He's not even having to be handcuffed or take a mugshot, it's actually insulting that they're coddling him

  • @slideszi

    @slideszi

    Жыл бұрын

    Because it is politically motivated , this is like what banana republics in africa do

  • @derpeth2101

    @derpeth2101

    Жыл бұрын

    @@slideszi Based banana republics in Africa

  • @PaullyRobots
    @PaullyRobots Жыл бұрын

    Listening to these people do their lil "investigative" thing is like watching your cat investigate what happened to the red dot after you turn off the laser.

  • @Matt-ru5rw

    @Matt-ru5rw

    Жыл бұрын

    😂😂😂

  • @mpjstuff

    @mpjstuff

    Жыл бұрын

    I'm laughing too hard at this. I'm imagining Tucker Carlson doing "Cats" on Dancing with the Stars. It's so vivid. He really does want to swat that glowing red light. Probably missed his calling.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca Жыл бұрын

    I love the ambulance guy. The theory that democrats took over the office of president illegally but because of some legal technicality need to respect the true presidents legal status by providing a single ambulance is my new favourite conspiracy theory.

  • @MisterPenguin42
    @MisterPenguin42 Жыл бұрын

    "Is the indictment of your predecessor politically divisive?" It's New York, they have states' rights.

  • @phantomyouneverwanted7378
    @phantomyouneverwanted7378 Жыл бұрын

    Fun fact: That cover of "Zombie" was done by Bad Wolves and it was to honour the death of Dolores Riordan and the proceeds from that song had gone to her children. Not saying the song isn't butt rock but a nice story to come for a funny joke on stream!

  • @pimpymcswaggins208
    @pimpymcswaggins208 Жыл бұрын

    Hasan reviewing these TikToks in a Texan Tie is too funny. Man’s looking fly af 💀

  • @Ferjermi
    @Ferjermi Жыл бұрын

    All I could think with the Kid Rock thing was "You destroyed.. about $8 worth of Bud Light? I don't get it."

  • @batman40528

    @batman40528

    Жыл бұрын

    $8 worth of bud light THAT HE BOUGHT

  • @rve420

    @rve420

    Жыл бұрын

    @@batman40528 Reminds me of people cutting up and burning the Nike products they already paid for. Nike already has your money....

  • @kylecook7187

    @kylecook7187

    Жыл бұрын

    Right? Like, a 30 rack is only about 25 bucks.

  • @SilverPrince_

    @SilverPrince_

    Жыл бұрын

    What's funny is that Kid Rock drinks Bud Light lmao A shit beer destroyed by a shit person who bought it lmao

  • @OfficerDva444

    @OfficerDva444

    Жыл бұрын

    He's not a Kid or a rock either! D:

  • @Gram72534
    @Gram72534 Жыл бұрын

    I got caught behind Obama's group in Colorado when he was running for president. They closed the hwy until the whole group passed. There were at least 4 bus's and cop car's and bikes ect, there was also a ambulance and he was only a senator... These people are as sharp as a weffle ball!!!

  • @kandimeep
    @kandimeep Жыл бұрын

    "schizophrenic" - sir do not associate my crazy with his crazy pls. 😂

  • @JulietteKernDiamond

    @JulietteKernDiamond

    Жыл бұрын

    Right I just hear voices that "aren't there" you'd never catch me being a hog lol

  • @jonhamilton5789
    @jonhamilton5789 Жыл бұрын

    It’s hilarious that Tucker has 2 “lawyers” on his show that apparently can’t figure out what crimes are listed in the indictment. Such brilliant legal minds.

  • @Aetoyt
    @Aetoyt Жыл бұрын

    Fun fact that cover of Zombies was approved by Dolores (lead singer of Cranberries & original singer of Zombies) and she was meant to sing on it herself but a week before she flew out to LA to record vocals she took her own life. They released that version of Zombies as a tribute to her life and work and the song itself is heavily anti-war and anti-conservativism. So he just talked about how great Trump is and how liberals are stupid in front of the absolute worst song choice. But it had a man singing growly a popular song so he thought it'd be badass.

  • @ham7307

    @ham7307

    Жыл бұрын

    same energy as conservatives using american idiot by greenday

  • @davidnissim589

    @davidnissim589

    Жыл бұрын

    the singer of the band that did the cover is actually a hardcore Trump sympathizer (which is ironic, because he covered Zombie). He left the band a few years ago and tried to frame it as "cancel culture", which he's been getting a lot of praise from right-wing media for, so maybe that's why the guy in the video is using it.

  • @douchopotamus3755
    @douchopotamus3755 Жыл бұрын

    What's crazy to me is all these people thought that other people should hear their thoughts. The ego of it.

  • @getoffamycloud9844
    @getoffamycloud9844 Жыл бұрын

    You'll note that these cowards weren't in NYC. Come out of your box and deal with society.

  • @PhoenixFireZero

    @PhoenixFireZero

    Жыл бұрын

    ​@tinyloonavebaby70thstreetit's almost like the American condition entails talking a lot of big shit and giving no follow-through

  • @PartnershipsForYou

    @PartnershipsForYou

    Жыл бұрын

    Mommy and Daddy’s farm property is sooo much nicer and safer. Plenty of room to run around, Fox News on 24/7. Why would they leave Hog Paradise?

  • @Velvetx4cove

    @Velvetx4cove

    Жыл бұрын

    I'm reminded that everytime self-proclaimed Nazis show up to places like Philadelphia they get a big ass reality check. They'll get knocked tf out and leave with their tails between their legs in a heartbeat.

  • @j-dubb614
    @j-dubb614 Жыл бұрын

    I live in Ohio. Every day is hogwatch.

  • @lim4275

    @lim4275

    Жыл бұрын

    Word

  • @rolloxra670

    @rolloxra670

    Жыл бұрын

    My condolences

  • @rolloxra670

    @rolloxra670

    Жыл бұрын

    My condolences

  • @pllpsy665
    @pllpsy665 Жыл бұрын

    9:44 This is the damn problem. This is the level of ignorance about everything these people are working with. The sad part is that instead of reassessing everything he thinks when he realized how fucked his knowledge base is he decided to double down.

  • @Rexini_Kobalt

    @Rexini_Kobalt

    Жыл бұрын

    dude is living in an rv it looks like, so...

  • @littleealyssax0x
    @littleealyssax0x Жыл бұрын

    @hasanabi you can call Hogs paranoid, but please don’t use “Schizophrenic” as an adjective. Someone can HAVE schizophrenia, but to say someone IS Schizophrenic makes the already stigmatized diagnosis into a Caricature. If someone is sad they don’t say “they are so depression”.

  • @rexana_rexana

    @rexana_rexana

    Жыл бұрын

    FINALLY I found someone else who noticed that! It made me feel really bad that he kept using that. He has such a large audience, he's just reinforcing that stigma to them.

  • @Julia-tk2em

    @Julia-tk2em

    Жыл бұрын

    Thank you. I have Schizophrenia and the overuse of the term is both harmful and hurtful.

  • @littleealyssax0x

    @littleealyssax0x

    Жыл бұрын

    @@Julia-tk2em I think people with schizophrenia have a gift. They see the world in a different lens & society needs ppl who think outside of those narrow boxes that we are supposed to conform to. I work mental health and it irks me when even doctors say “they’re schizophrenic”. No they HAVE schizophrenia. So thanks 4 being u!! 🖤

  • @littleealyssax0x

    @littleealyssax0x

    Жыл бұрын

    @@rexana_rexana I know, I hope he sees this so he can just learn the right verbiage.

  • @eviebee
    @eviebee Жыл бұрын

    after ppl staring, laughing, harassed and being generally creepy towards me for being trans, it makes me feel so comfortable to watch hasan

  • @smolapril
    @smolapril Жыл бұрын

    there's a thin line between hog watch being funny and borderline vomit inducing

  • @Silvermoon424
    @Silvermoon424 Жыл бұрын

    Hasan's Tucker Carlson impersonation is always 10/10

  • @MexicanTeTe
    @MexicanTeTe Жыл бұрын

    Before social media you'd only see these people talking conspiracy theories and politics while stumbling around down at your local rural bar. Now they feel emboldened and extra vocal because they see each other post their nonsense online.

  • @johnathanwalker8395
    @johnathanwalker8395 Жыл бұрын

    The irony of military industrial cumplex loser ranting with an anti war song literally calling him a ZOMBIE in the background is so rich I'm having to take really small bites.

  • @richarddavenport6756
    @richarddavenport6756 Жыл бұрын

    Hogwatch needs to be a weekly segment. I was crying with laughter watching this live

  • @alleypez8555

    @alleypez8555

    Жыл бұрын

    Absolutely

  • @clusterfox6143
    @clusterfox6143 Жыл бұрын

    The Trump court sketch makes him look like the grinch. I love it.

  • @smileymalaise
    @smileymalaise Жыл бұрын

    Hasan's cover of Zombie has now hit #7 on Billboard top 100.

  • @A2Z83

    @A2Z83

    Жыл бұрын

    better than that buttrock cover by bad wolves who had to ditch their singer because he was too much of an unhinged trump supporter.

  • @lizardbytheriver1567
    @lizardbytheriver1567 Жыл бұрын

    Biden just smiling/laughing at that Trump Question is lowkey one of the coolest things Biden's done.

  • @H3r0oftheday0622
    @H3r0oftheday0622 Жыл бұрын

    Imagine being this angry when you're doing so well. The privilege of these people

  • @dickeyseamus
    @dickeyseamus Жыл бұрын

    It's like these dudes evolved so that beard development takes precedent over brain development. Fascinating!

  • @patteraj
    @patteraj Жыл бұрын

    Hogs sure love to give money to a company for their product and then record themselves destroying said product.

  • @jturppa1234
    @jturppa1234 Жыл бұрын

    The butt rock singing 😂

  • @Dudewithhat9531
    @Dudewithhat9531 Жыл бұрын

    its just sad to see the lack of critical thinking from most people in the world.

  • @donaldlahoda8693
    @donaldlahoda8693 Жыл бұрын

    I can only watch a couple minutes of these before I start to feel my brain become smooth.

  • @xezevahc

    @xezevahc

    Жыл бұрын

    I suggest you broaden your scope of the content you consume then. While some of these people were very silly the main point still stands which is that this is an incredibly weak case and even after they pursue this do you genuinely think they're gonna go after anyone else who did the exact same thing? The answer is obviously no because this is a political move.

  • @t3rrschxx102

    @t3rrschxx102

    Жыл бұрын

    @@xezevahc most of hasans viewers would agree with your statement

  • @donaldlahoda8693

    @donaldlahoda8693

    Жыл бұрын

    @@xezevahc don't worry chavez, fact is I'm never going to be able to afford to illegally move 130,000 bucks around to keep a porn star quite while I'm running for office. So I'm not worried about what happens at all. I just think folks who follow politics like it's a wwe storyline are ridiculous.

  • @xezevahc

    @xezevahc

    Жыл бұрын

    @@donaldlahoda8693 that’s actually a great point. For the most part I was referring to politicians who have done the exact same thing. But you are right American politics for the majority of people is just a theatrical performance. It’s like people subconsciously think it’s not real and there aren’t real consequences to what these politicians are doing. The majority of people don’t take politics seriously at all.

  • @Morecado
    @Morecado Жыл бұрын

    Cranberries singer O'Riordan was supposed to be part of that cover of the song, but unfortunately passed away some time right before the recording could take place. The cover band later recorded the song as a tribute to her. I believe they changed the lyrics slightly to reference O'Riordan's passing. I hate the way it was used for that goof's TikTok.

  • @harrydsgn
    @harrydsgn Жыл бұрын

    Something about MTG saying Jesus was killed by a 'Radical' government is so funny to me. He was literally killed for being that time period's version of a 'radical' lmao

  • @SuperKiao

    @SuperKiao

    Жыл бұрын

    Ew. Do you think you’re a woman?

  • @OfficerDva444

    @OfficerDva444

    Жыл бұрын

    Conservatism also tends 2 fantasize about The Roman government that ended up killing Jesus too...

  • @spockmandia
    @spockmandia Жыл бұрын

    The best part about the Kid Rock video is that he missed most of the beer with his MACHINE GUN.

  • @drewgoin8849

    @drewgoin8849

    Жыл бұрын

    There's a photo of Kid Rock hanging out with a drag queen from 2003 - and he's drinking a Bud Light!!!

  • @CoutureThug

    @CoutureThug

    Жыл бұрын

    ​@@drewgoin8849 he was at a drag show drinking bud light lol. But we all know he was a culture vulture, he's the biggest sheep and doesn't even know it

  • @AlliSinned
    @AlliSinned Жыл бұрын

    5:23 Former Presidents famously don't ever need medical attention ever again

  • @yellowfelloh
    @yellowfelloh Жыл бұрын

    Love to see him in his Sunday's best on this fine occasion. Thank you for reporting the Hogwatch o7

  • @biskitboi2476
    @biskitboi2476 Жыл бұрын

    That cover of Zombies was meant to have the Cranberries' singer do the vocals but she died like the day before, they put a little commemorative thing at the start of the music video

  • @MarillSweatshirt
    @MarillSweatshirt Жыл бұрын

    4:27: "this is the beginning of communism in this country....." With his American flags, police memorabilia, overt dedication to leaders that would rather watch him game end, no understanding of communism and......

  • @MrZadir-nu7bd

    @MrZadir-nu7bd

    Жыл бұрын

    Not the brightest bulb is he?

  • @pelletized
    @pelletized Жыл бұрын

    i say 'i'm sorry' all the time, what does that say about our society?! 😭

  • @pllpsy665

    @pllpsy665

    Жыл бұрын

    We live in one ...

  • @Gunbudder
    @Gunbudder Жыл бұрын

    14:55 that is literally a $50,000 gun. Bob is so far out of touch with his fake "trailer" persona that he's lapped back around to the rich kid he grew up as. And yes, his name is Bob Ritchie.

  • @NessaH
    @NessaH Жыл бұрын

    “I’ll be transitioning to a different beer company”💀💀

  • @Ironraven001
    @Ironraven001 Жыл бұрын

    Your reaction at 12:30 to that Boomer lady with the "describe your video" box 😂😂😂😂😂

  • @TheOnward72

    @TheOnward72

    Жыл бұрын

    12:00

  • @PhoenixFireZero

    @PhoenixFireZero

    Жыл бұрын

    Giving boomers access to technology was a mistake

  • @PMac13
    @PMac13 Жыл бұрын

    I had an ambulance follow me for 6 miles last night while I did 20mph down the center of the road and its sirens blared. I am President now.

  • @thegargoylecumeth7932
    @thegargoylecumeth7932 Жыл бұрын

    That ambulance theory is the best pudding-brained evidence I've ever seen 😂

  • @lukecarter9531
    @lukecarter9531 Жыл бұрын

    The lead paint generation is really showing up today

  • @thepolarphantasm2319
    @thepolarphantasm2319 Жыл бұрын

    Bro, Catturd 😂😂😂 "fetterman's head transplant" 😂😂😂 these people are definitely on one

  • @PartnershipsForYou

    @PartnershipsForYou

    Жыл бұрын

    Based catturd showing us the inner workings of a right winger/dementia patient’s mind

  • @paranoiddroid9570
    @paranoiddroid9570 Жыл бұрын

    What kills me the most is that these same people that preach about hating China are using a Chinese spyware app to post their content 😂 the jokes write themselves.

  • @Matt-ru5rw

    @Matt-ru5rw

    Жыл бұрын

    They're the same dummies yelling about keeping the government out of their Medicare.

  • @Hankthespank
    @Hankthespank Жыл бұрын

    Dude im so fucking happy over this shit starting again. May the conspiracy theories flood and sustain me for another year!🤌

  • @nickroeder7512
    @nickroeder7512 Жыл бұрын

    I have to say this is one of the greatest videos ive seen in a while

  • @meanjeanmcqueen6171
    @meanjeanmcqueen6171 Жыл бұрын

    My Mom raised me on conspiracies. Thankfully I eventually got away from it, but I've noticed there ALL the same and none have come true, lol.

  • @Yogabear123
    @Yogabear123 Жыл бұрын

    You put a smile on my face bud. Thanks for a funny video.

  • @miricobladetail9670
    @miricobladetail9670 Жыл бұрын

    God I wish I could read Tucker's texts during this.

  • @thepolarphantasm2319

    @thepolarphantasm2319

    Жыл бұрын

    It's all about how envious he is of Hasan's bolo tie

  • @MultiKatieBee
    @MultiKatieBee Жыл бұрын

    Hasan in his suit era wearing a bolo tie is 🔥

  • @staomruel
    @staomruel Жыл бұрын

    Love the dude that thought the Stormy story was true until he found out she wasn't a senator.

  • @braidena1633
    @braidena1633 Жыл бұрын

    "While we're on the subject of Biden" No we weren't

  • @zed739
    @zed739 Жыл бұрын

    10:10 who the fuck would just admit this to their friends and relatives lmfao

  • @chrispawley6743
    @chrispawley6743 Жыл бұрын

    Really insightful stuff. I learn so much about how to shout at strangers in the street or in forums from content like this 😂

  • @limitbreak2966
    @limitbreak2966 Жыл бұрын

    1:14 did this guy literally just say head transplant? LMFAOOO that’s not possible yet

  • @thattheatrenerd1418
    @thattheatrenerd1418 Жыл бұрын

    Is it me or does the Trump courtroom sketch look like the original animated Grinch if he fell into a vat of Cheto dust

  • @ethankillion786
    @ethankillion786 Жыл бұрын

    I think the knee-jerk reaction is this will help him in the primary - at the very least providing a huge fundraising boost, but it’s hard to imagine this isn’t a massive blow to his chances with non-MAGA independents he needs to win the general.

  • @DizzyedUpGirl
    @DizzyedUpGirl Жыл бұрын

    Imagine crying over someone you've never met getting arrested

  • @chestypants78
    @chestypants78 Жыл бұрын

    Senator Stormy LOL

  • @lirpa5
    @lirpa5 Жыл бұрын

    I love your Hogwatch videos. You should make more.

  • @Leo-gl4lb
    @Leo-gl4lb Жыл бұрын

    6:04 bro went nah to airforce one, went straight to ambulance force one 💀

  • @KingJT80
    @KingJT80 Жыл бұрын

    i swear if i hear Hyena Carlson laugh one more time...

  • @jacobkalbfleisch5431
    @jacobkalbfleisch5431 Жыл бұрын

    Conservatives on TikTok talk about Trump like he's Goku or some shit

  • @bluesstinger1975
    @bluesstinger1975 Жыл бұрын

    The American Circus still rolls on, thank you for all your comedy gold repugs

  • @vassinarain
    @vassinarain Жыл бұрын

    I love how she didn’t mention Assange or Snowden in the list of persecuted people

  • @DRACOCHIEF
    @DRACOCHIEF Жыл бұрын

    Thought the lady at 8:25 said "I'm gon need you to get a nazi" instead of "nice seat". Lol still the point stands though, she's talking a whole lot of nothing.

  • @WonLotto100M
    @WonLotto100M Жыл бұрын

    Hasán you roasting the MAGA HAT Cuban guy from Miami just made my day! Oh my goodness.

  • @lazyxknight685
    @lazyxknight685 Жыл бұрын

    Fuk I'm so fortunate I'm Australian. Health care n no guns. No one refers to us as "socialist" for this

  • @xXRickTrolledXx

    @xXRickTrolledXx

    Жыл бұрын

    Stop rubbing it in, it hurts :(

  • @lazyxknight685

    @lazyxknight685

    Жыл бұрын

    @@xXRickTrolledXx all the big fuk off spiders/snakes replace the fear of shootings so dont worry it balances out

  • @ErikLeeTroche
    @ErikLeeTroche Жыл бұрын

    damn kidrock really bought beer just to shoot it. 😭

  • @alisonmcrae1281

    @alisonmcrae1281

    Жыл бұрын

    I know what an idiot....

  • @PartnershipsForYou

    @PartnershipsForYou

    Жыл бұрын

    Kid rock looks so weird now he’s like a alien

  • @thechief043
    @thechief043 Жыл бұрын

    Hogwatch is back baby!!

  • @bhambhole
    @bhambhole Жыл бұрын

    I love watching these older videos and knowing how things have evolved ever since.

  • @itsd0nk
    @itsd0nk Жыл бұрын

    I would be slowly dialing 911 in my pocket if that first guy came up to my face and started talking to me like that at the park somewhere.

  • @bloo9699
    @bloo9699 Жыл бұрын

    "go out like a man" (cause I'm too chicken to)

  • @thenewmase
    @thenewmase Жыл бұрын

    they keep saying the crime is not listed because they know their audience it's either not going to read it or too stupid to know how to read

  • @professorpancakes6545
    @professorpancakes6545 Жыл бұрын

    Yes hogwatch is back!!!

  • @batsardcat3285
    @batsardcat3285 Жыл бұрын

    Meth is a hell of a drug