To anyone watching the gun part that isn't a stand user, it would just look like the gun is just floating....

@TheOverlordEND

2 жыл бұрын

Yep, but no one was watching at that time except for Jolyne and Pucci.

@USSBOAT

2 жыл бұрын

@@TheOverlordEND sadly

@tonygun2533

2 жыл бұрын

mcqueen could see whitesnake giving the discs did not see them float?

@Toji-gl4vi

2 жыл бұрын

Whitensnake is basically like one of those stand that can be seen by non stand-users , sort of like Love Deluxe and Anubis

@TheOverlordEND

2 жыл бұрын

@@Toji-gl4vi Wait, really? That would explain why Pucci didn't end Jolyne despite the stand couldn't be seen by people because he is afraid normal people would seen it. But there wasn't any explanation that White Snake can be seen by normal people.

A stand that makes you dream while being dissolved by acid whiletaking your mind and stand in form of a disc which can be inserted into other people. You can't deny that this is quite *bizarre*

@joeydellova8668

2 жыл бұрын

He did it he said the thing

@stinkymonke3622

2 жыл бұрын

for his neutral special, he wields a gun

@shishain4434

2 жыл бұрын

1 question , can he survive from EMERALD SPLASH

@abvlah

2 жыл бұрын

Cool*

@gawkgawk1000

2 жыл бұрын

Spoiler Plus he can disguise into somebody in a short time

0:40 i can rewatch this scene so many times, it's so crazy to me that this finally got animated

@flamingdoge6242

2 жыл бұрын

I’ve already watched this scene like 75 times by now. I absolutely love Whitesnake/Pucci, and the music + terrifying idea of Jotaro being rendered a vegetable in just one swipe of a hand + Whitesnake’s elated voice inflection is just perfect

@Susnose

2 жыл бұрын

i re-watch it everyday

@gamersfun98

2 жыл бұрын

Just wait for the next 2 steps behind

@ssmetallic

2 жыл бұрын

@@gamersfun98 honestly the heavenly horse would be so cool animated

@rycegabrielmajor9847

Жыл бұрын

@@ssmetallic yeah, can't wait to watch it in 2023/2024... why does netflix have to do this to us

Love him. Plus, his name is White snake but he is literally Slime Shady

@AWholeLegionary

2 жыл бұрын

I hate how this would have been a better name.

@hisoka568

2 жыл бұрын

100% prefer slime shady

@nova_supreme8390

2 жыл бұрын

@This channel got trashed No! Bad coomer! BAD!

@kaikysouza9861

2 жыл бұрын

Whitesnake, Palesnake, Slime Shady or even Whitevenom, any name is good

@SandMan1998

2 жыл бұрын

U mean pale snake

2:39 White Snake throwing light jabs at poison dart frogs is something I never knew I needed.

@Rony_15.33

2 жыл бұрын

This barrage was horrible

@falcorthewishdragon3657

2 жыл бұрын

@@Rony_15.33 he was punching frogs, so he held back

@Rony_15.33

2 жыл бұрын

@@falcorthewishdragon3657 but all his punches are horrible from afar

@carved7140

2 жыл бұрын

@@Rony_15.33 well white snake is weak compared to star plat, so he doesn't go haywire 💀

@electric_creeper

2 жыл бұрын

@@Rony_15.33 *complaining about stand with D tier speed having a bad barrage*

He has a very long range, multiple abilities, his own voice/personality, interesting powers and cool design. He is a chad

@brendanlee6551

2 жыл бұрын

Tooru : so its same type of stats as Wonder Of U

@brzodroid

2 жыл бұрын

Isn't getting discs his only ability? And of course from that you can get more stands. Or did he have the sleeping stand from the beginning?

@jovif.spemudaindonesia1841

2 жыл бұрын

Only 20 meter bruh

@KakaCarrotCake.

2 жыл бұрын

@@brzodroid the dreaming ability yes is also part of his power. He can also enslave people and make them obey orders (like the exploding frog or the guard shooting at Jolyne)

@tonijelecevic9238

2 жыл бұрын

This isn't even his final form

0:54 oh god that voice🙌

@LucasSantos-ce2sw

2 жыл бұрын

Eyzo

@LegendaryITA

2 жыл бұрын

@@LucasSantos-ce2sw Ez*

@asylbektursynbai

2 жыл бұрын

Sudeni dekte itana

@danielendless

2 жыл бұрын

@@asylbektursynbai 👌

@asylbektursynbai

2 жыл бұрын

@@danielendless ???

This is my most favorite stand ever.

@averymoore7772

2 жыл бұрын

Same

@aisarfahmi7659

2 жыл бұрын

Yea same doe he look badass

@roofs817

2 жыл бұрын

I think it has the best design so far

@jiandog4225

2 жыл бұрын

@@roofs817 like van darkholme gachiBASS

@stand_user-yb3ee1ts5s

2 жыл бұрын

Me to and godlen experience raqwiam

This stand literally have it own personality

@Johnnysins-ei1ym

2 жыл бұрын

Like purple haze

@valdaandriansyah4663

2 жыл бұрын

like echo stand koichi kun

@davidsanchez-lw6id

2 жыл бұрын

@Kurt golden experience requiem is Giornos sub conscious

@andrewww52

2 жыл бұрын

Like cheap trick

@euyra

2 жыл бұрын

@@andrewww52 cheap trick is the stand user's personality

3:40 he looks happy in this scene 🤣🤣

@daddymyers2599

2 жыл бұрын

It's adorable and I don't know why

what makes white snake scary is that he has its own personality and *he can grab guns and try to shoot at you like as if its not a stand*

@diegobrando3409

2 жыл бұрын

And his range is the same as hirophant green, he can still totally reach you no matter how far you run. The gun just adds disrespect.

@nikemegu1142

2 жыл бұрын

@@diegobrando3409 and once he reaches max range, he can still just snipe you with a gun Like imagine getting away, you think youre safe so you rest and mf starts just blasting

@diegobrando3409

2 жыл бұрын

@@nikemegu1142 "lemme tell you right now before we go any further, they'll be no fightin me, I shoot mothafuckas" -whitesnake

@wonderofu230

2 жыл бұрын

@@nikemegu1142 He can also throw discs lol

@diegobrando3409

2 жыл бұрын

@@0202fran It might reflect his psyche. Pucci does truly evil things throughout the part. But he usually never does them directly and even justify it and remaining completely ignorant to what he is doing, distancing himself from the truth. Whitesnake is who pucci is deep down, but he keeps his own evil intentions so far in his soul they are given form. And since whitesnake thinks for himself he can just not even think about the brutality and cruelty he is dishing out to the guards and prisoners. It makes sense for whitesnake be such.

I like how they made White Snakes punching and disc sound effects slimy and squishy. Makes its acid attack feel consistent with the rest of its abilities.

2:59 zamn ws is being so realistic

@KinguKirimuzon

2 жыл бұрын

“Get real”

@SmallSimin123

2 жыл бұрын

Because of numbers on body

@woopterthewooper1263

2 жыл бұрын

@@SmallSimin123 it would be evil to force the animators to draw the patterns on his skin

@mr_box1264

2 жыл бұрын

@@woopterthewooper1263 GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC

@kazuma8486

2 жыл бұрын

@@woopterthewooper1263 probably CGI

White Snake's personality is just epic. I really would've wished for a Stand like that, to talk with when nobody else have free time.

@veteranpg3d156

2 жыл бұрын

Isn’t he evil?

@foxy4111

2 жыл бұрын

@@veteranpg3d156 well he is, but ofc it's because of Pucci personality. If someone kind would have Whitesnake he would be also kind... Kindsnake...

@dinoboi7756

Жыл бұрын

I wonder how WhiteSnake's abilities could be used for more benevolent purposes. The only one I can think of at the moment is removing a Stand from someone not strong enough to have one, like when Holly got sick.

@foxy4111

Жыл бұрын

@@dinoboi7756 deleting the harsh memories or traumas.

@Narvalo_Lastar

Жыл бұрын

@@dinoboi7756 Perfect anesthesia

0:43 was so scary but 🔥 at the same time.

This stand has it’s personality and voice, his range is 20 meter, his ability is powerful and that’s will make his user mysterious and dangerous , this is very smart way to make the villain dangerous to the protagonist without making theme overpowered or immortal only

Bro literally can play DVD on everyone

@marusdod3685

2 жыл бұрын

i can also play dvd on him

Bro, idc if the the heros lose.. Whitesnake is just too *epik*. His voice, His style, His powers MMMMMM IT'S JUST TOO GOOD BRO!! Y'all ready for C-moon?

@Daniel_Scarlet

2 жыл бұрын

Can't wait to see C-moon) Btw when will thete be more episodes?

@marusdod3685

2 жыл бұрын

I hope they don't change his voice

@ReverseToast

2 жыл бұрын

@@Daniel_Scarlet like March I think

@ironicjason257

2 жыл бұрын

Cmoon one of my favourite stands

@andrealderman3514

2 жыл бұрын

they don´t lose and c moon doesn´t show till near the last episode

Whitesnake is one of the coolest stands ever.

Bro ws saying “ez” after getting Jotaro’s disk

@laugh6519

2 жыл бұрын

Yba players.

@TheRealLefishe

2 жыл бұрын

@@laugh6519 yba moment

@3junqn1913

2 жыл бұрын

yba do be like that d o e

@TheGoat10040

2 жыл бұрын

🤓🤓🤓

@1sak_010

2 жыл бұрын

Yba Joe after killing a prestige 0

I just noticed when WS gets Jotaro's memory and stand disc those have the form of where they came from (One has the form of Jotaro's hat hand and one has the form of his nose)

@spamtongspamton2605

2 жыл бұрын

Oh wow I did not see that

@bluepikmin3242

2 жыл бұрын

I was wondering why the bumps were gone later on and thinking about it makes so much sense

@Narvalo_Lastar

Жыл бұрын

I've never thought about that

The voice sounds so scary but epic at the same time

One of the most broken Stands. Long range, decent strength despite its range, acid/dream ability, and the fucking DISC ability that made quick work of Jotaro, give abilities to people, and even give commands like make something explode??? Worst part is this isn't even its final form

@humanoid251

2 жыл бұрын

I only know the stands from the anime so far, but he’s basically a combination of: -Yellow Temperance/Ratt/Notorious BIG/Green Day (corrosion) -Death 13 (dream manipulation) -Osiris/Atum (soul stealing) -Boy II Man (Stand stealing) -Black Sabbath (giving people Stands) -Hierophant Green/Justice/Heaven’s Door/Surface (puppeteering/commands) -Killer Queen (making things explode)

@ckdgyp9149

2 жыл бұрын

@@humanoid251 i feel it’s more like heaven’s door in the sense he can add/remove aspects of a person

@dinoboi7756

Жыл бұрын

@@humanoid251 I agree for the most part, but I just wanted to say that WhiteSnake doesn't control dreams, it simply makes people fall asleep, sorta. Meanwhile, Death 13 could control dreams, but it couldn't make people fall asleep, it had to wait for them to

@radicularchaos3071

Жыл бұрын

@@dinoboi7756 I wouldn’t even say it puts them to sleep it just puts them in an illusion dream sort of state since white snake injected Manhattan transfer into the dream even though jotaro and Jolyne had never seen it before

@zillafire101

Жыл бұрын

Whitesnake is shown to be very weak in a fight. Stone Free, Diver Down and Weather Report all hand him his arse in a straight fight.

2:03 “It was just bait bro”

@d9zirable

2 жыл бұрын

[insert whitesnake as a wojak]

The different personalities really create some weird situation, like how the first attack it was Pucci himself controlling, cold and ambitious. And last act is White Snake's personality itself, childish and rushing.

@asmagamer728

2 жыл бұрын

Probably because he had succeeded in the first situation. In the second, he was swearing and yelling since the stand disc was out of his reach and he failed at protecting the discs. The situations were basically a demonstration of pucci’s volatile mindset and desperate attempts at dealing with situations against him or just failure in general.

@mr_box1264

2 жыл бұрын

@@asmagamer728 seeing the stand cursing by himself is actually quite funny

@asmagamer728

2 жыл бұрын

@@mr_box1264 Ikr lmao

You're no longer the protagonist, Jotaro!

@nova_supreme8390

2 жыл бұрын

Old Jospeh: You'll get used to it like I did. "pats on shoulder"

@Shadex_Joestar

Жыл бұрын

Giorno:wait,you were a Main Character in more than 1 part?

the coom stand

@fearmination6996

2 жыл бұрын

*C o o m s n e k*

@MrTrollmaster0

2 жыл бұрын

Now we know why he’s called white snake

He can do the flurry barrage punch Put people in a deep sleep real like dream Slowly melt w acid Stole a memory Stole a stand Give a stand Give a memory Hold a gun 20M effective range Can be evolved twice Can speak and have mind on his own Can utilise multiple stand power like the one that he make the frog explode They really make him one of the broken stand

@seeforkat

Жыл бұрын

But he's still not the strongest.

@awesomenurmzamri5789

Жыл бұрын

@@seeforkat yeah he's not the strongest. He lost to stone free easily. His stand aren't made for brute force but rather as a strategist and the users require battle iq for it. It's balance since he's not strong. But he have more advantages than disadvantages

@robingood1325

Жыл бұрын

@@awesomenurmzamri5789 like Kirah Quin

@TovKafur

Жыл бұрын

Theoretically anyone following the path to Heaven could have their Stand evolved. Dio initially presumed that it will be him who will achieve the Heaven, so it is at least not Whitesnake exclusive.

@souviksarkar5384

Жыл бұрын

can control anyone can create illusion can shapeshift can play mixtape

Tomokazu seki did perfection in both Pucci and White Snake

1:18 Manga : Just like the killer who killed Kennedy...

@Gaciet017

2 жыл бұрын

He said that in the manga?

@bravoprozac7620

2 жыл бұрын

@@Gaciet017 yeah. in the manga he said about the killer of Lee Oswald, the one that assassinate JFK

@seeforkat

2 жыл бұрын

@@bravoprozac7620 A shame these cultural references were removed

0:42 listening to whitesnake speak is just good for the soul

2:40 whitesnake just wildly throwing punches makes me laugh for some reason

White Snake constantly sounds wheezy and sort of tired, I love it

3:17 that frog is lucky god damn it.

@user-jj4pj5xg5t

Жыл бұрын

Ah, a frog of culture I see

That slime sound effect is so satisfying. The sound design is amazing.

People seem to forget how fucking OP White Snake is: -20 meters range -above average power and speed -can extract people memory and stands (1 shot ability) -can use the stolen stands to make enemies -can read anyone memory even if he incompatible with stand -can FUCKING COMMAND ORGANISMS with DISCs -can trap you in your sleep and kill you in your sleep by melting you away -can project whatever the HELL he wants in the dream realm Downside: is visible (but can still scare away non stand users probably lmao)

@coostard5971

11 ай бұрын

blowing up the frog isn’t a power he just hit it really hard with the disc lmaooo

@dynamitoriel9056

9 ай бұрын

I wonder what he look like from non-stand user eyes considering he seems to be made out with same liquid he spitting for the majority of his body

@Hans172.

5 ай бұрын

He can also disguise as anyone with enough smoke

@Whitesnake273

4 ай бұрын

​@@coostard5971 No?

@Whitesnake273

4 ай бұрын

Not exactly visible, but partially

Whitesnake having a seemingly global range, is sentient yet still has the strength of a close range stand is baffling, but most of all *his damn good voice* is just 👌

@Narvalo_Lastar

Жыл бұрын

He has the strength of a close range stand only at close range

@explorercompass0167

Жыл бұрын

His range is bout 20 meters

@notsocrazytank707

Жыл бұрын

@@Narvalo_Lastar I guess it's a callback to how Star Platinum brought stuff for Jotaro in part 3

@myronbourne6937

Жыл бұрын

He's not as strong as close range stands. He's probably weaker than killer queen

@notsocrazytank707

Жыл бұрын

@@myronbourne6937 He seemed to be really good against Stone Free. I guess Pucci just guesses how enemies will attack from his experience

0:31 Thats just epic

0:56 The disc on the top has a ridge. His hat is officially a part of his body.

the : "I found it" fits so fucking well

@lazernor

2 жыл бұрын

3:40

@robertlupa8273

Жыл бұрын

"Atta zo!"

Jotaro has been "DISC"qualified from being a stand user

@Gabycretin

2 жыл бұрын

🤣🤣🤣🤣🤣

@julianss550

2 жыл бұрын

for now, and then pucci dies

@averagemusiclover

2 жыл бұрын

@@julianss550 uhh how should i put this

@averagemusiclover

2 жыл бұрын

@@julianss550 pucci did die but uhhhhhhhh

@FROST_HUGGER

2 жыл бұрын

@@averagemusiclover dont do it my man

1:03 oh dont mind me i think this line is cool

2:48 Pucci: Pale Snake! Give me a disc! Whitesnake: ok bro

@LordZygon

2 жыл бұрын

Why tf Whitesnake have a nose?

@darwinwatterson4568

Жыл бұрын

@@LordZygon woah! i wonder if that was in the manga too?

"This is my kingdom come, This is my kingdom comeeee"

@GooserMan

2 жыл бұрын

@ׁ for a mouse, you’re pretty active on the internet

I like how intellectual whitesnake is.

I just realized now how funny is that Pucci decided that he was more fitting to thrown a disc at a frog than his stand

@diamond-heart21

2 жыл бұрын

Oh it's because his stand was protecting him from the incoming frogs

0:56 Whitesnake RKs Jotaro and says “ez”

@Rony_15.33

2 жыл бұрын

Whitesnake rker >:(

@tedobg4778

2 жыл бұрын

OMG IS THIS A YBA REFERRENCE. Jk ws bad get him be rker

This stand is legit asmr to me

I love how white snake has a personallity and emotions.

0:13 this is my kingdom come

This is probably my favorite stand in terms of sounds

I think part 6 definitely is my favorite artstyle wise when it comes to the anime, good mix between all the previous parts and future parts

I find whitesnake just so cool because he seems like he has a mind of his own

2:45 that sound.. "I order you!"

This is my favorite stand ever.

Whitesnake is smarter than all my classmates

"That's a Stand who can makes you dream whenever he wants !" Jotaro : *lali-ho flashback*

A stand that has crazy diamond level speed and strength with a 20 meter range is op as hell alone. Nevermind that he can turn into acid or steal parts of you and put them in dvds.

@michaelmorbillionmorbius3596

2 жыл бұрын

@@extremeos He is really strong. He comes very close to that level.

@michaelmorbillionmorbius3596

2 жыл бұрын

@@extremeos Whitesnake is literally able to go toe to toe with Stone Free at one point

@michaelmorbillionmorbius3596

2 жыл бұрын

@@extremeos you’re an anime only arent you

@michaelmorbillionmorbius3596

2 жыл бұрын

@@extremeos reread the manga then lol

@slipperylittlebastard2481

Жыл бұрын

@@michaelmorbillionmorbius3596 Anasui clearly states in the Heavy Weather arc that a close range power type stand could easily overpower and outspeed white snake

I was expecting Whitesnake to have literally the same voice and spoke the same way Pucci would, but after so long without watching the anime, i forgot that Stands actually spoke in a monotone, almost robotic way, i love that style honestly.

0:33 that voice tho

Man white snake's voice is epic

This is whitesnake kingdom C-

Stand + ability to speak normally = op

@toyohimeyeswatatsuki6917

2 жыл бұрын

Hey ya is OP? (I mean it's good advisor and motivator)

Jotaro lost his protagonist privileges.

@Gabycretin

2 жыл бұрын

He lost his plot-armour.

@princedaubeny

2 жыл бұрын

@@Gabycretin impossible

@Anika-Buster

2 жыл бұрын

@@Gabycretin I don’t get plot armor if it makes sense a character doesn’t die then how is it “plot armor’

I know I'm a bit late but I really love the sounds of the discs and the illusion made by Palesnake.

When getting jotaro disk. White snake: Ez

@averagemusiclover

2 жыл бұрын

Yba

@NotRed_23

2 жыл бұрын

Yba joe mama disk momeny

I love how pucci and white snake are just homies 😂😂😂

Jotaro being sad when jolyne hated him for being boring: 0:06

0:16 "This is my kingdom come"

The way he says “ezo” is so funny

Now we need part 2 :D

very relaxing

This is my kingdom come this is my kingdom come

0:01 this is my kingdom come

@obi8875

2 жыл бұрын

yes

@Rony_15.33

2 жыл бұрын

@@obi8875 no

@YourLocalBobloxPlayer

2 жыл бұрын

Oh my god- STOP WITH THIS MEME. ITS NOT FUNNY ANYMORE.

@user-zu1ir2mv2p

2 жыл бұрын

@@YourLocalBobloxPlayer bro- it was 4 months ago. At that moment it was still popular

3:45 love this part

I love how the gun is included as a part of Whitesnake's Sound Profile

1:38 My heart after meeting new people

@RoundedPotato

4 ай бұрын

. . .

このドロドロ音クセになる ASMR味を感じる

White Snake has a very nice voice acting and effects

ねっとりした声が不気味さを醸し出すホワイトスネイクですが、2倍速で再生すると不思議と怖さが薄れ、むしろハイテンションな感じのキャラに聞こえてきます。 1:15 「KOKODA☆」

Ngl, whitesnake disc ability is cool af

2:17 when F.F is sad I’m sad I don’t care If it’s not F.F yet it’s still F.F

I like how whitesnake basically puts you in a genjutsu

Slime sound profile

McQueen saw White Snake, which means that he would have had to already be a Stand user in the memory Hermes sees

@Mr_Myst13

2 жыл бұрын

Nope, McQueen only became a stand user after Whitesnake inserted the Highway to Hell disc... Plus remember that McQueen only had 2 discs when Ermes knocked him out, not 3... It's most likely that Whitesnake is visible even to non-stand users... This makes sense since Whitesnake is Pucci's stand-in when dealing with others, meaning that he must be visible else the stand can't communicate with non-stand users... This is also supported when Whitesnake retreated when guards started showing up at the end of the Operation Savage Garden arc, meaning that there's a chance others might see the stand without necessarily being stand users themselves...

@givlupi2686

2 жыл бұрын

@@Mr_Myst13 Except all the times when non-stand users don't see it because non-stand users can't see stands. Do you think it's just a coincidence that Highway To Hell fits McQueen so perfectly?

@HalohbotTech

2 жыл бұрын

No, that's untrue. There are types of Stands that are more corporeal than others in the series. These types of Stands can be seen by anyone, regardless of their capacity to see Stands. Usually they take the form of an object they’ve possessed, but that doesn't mean it's impossible for a humanoid Stand to be visible even while not bound to a normal object. How else do you explain how McQueen only had 2 disks yet could see Whitesnake? How else could Pucci use WS to be his voice if non-Stand Users can't even hear Stands (see the Aerosmith/Lil' Bomber fight from part 5)? WS is visible to non-Stand Users, hence why Pucci is so careful in How he gives people abilities, like when he knocked Miraschon out to give her Marilyn Manson/Mary Lee Manson.

@HalohbotTech

2 жыл бұрын

@@givlupi2686 Yes, it is. Straight up. If you're an anime-only, you’ll see what I mean next season when Jolyne returns to the Punishment Ward. There's a Stand User there whose nature matches what his given Stand ability does rather perfectly, and we know for a fact WS picked it up elsewhere. Whitesnake is one if the most unique Stands in the series, so stop treating it like a 'normal' Stand. Hell, it's one of a few Stands that have its own independent personalities, like Echoes or Spice Girl, which already sets it apart

Oh hell nah he got tyler the creator's mayongas

@ncxo1975

2 жыл бұрын

@Etg Sur KZread on an escalator

@silverius678

2 жыл бұрын

@@ncxo1975 hes going up

@stopplease6719

2 жыл бұрын

@@silverius678 so see ya later

I can’t wait for Whitesnake using a dude to play music to become a certified Jojo meme

Seeing his nucleotide bases not lining up properly makes my inner biologist scream in terror.

1:15 the way he delivers this line is lowkey creepy lol

@seeforkat

Жыл бұрын

It's sarcasm

Almost panicked when Jotaro was beaten

@euyra

2 жыл бұрын

Your fly is too low quality it cant trick me

@euyra

2 жыл бұрын

@Lord TDG im going fucking insane

@jotarouchiha5950

2 жыл бұрын

@Lord TDG I am going super Saiyan 17

@izimari

2 жыл бұрын

@@jotarouchiha5950 I’m going- wait what? Super Saiyan 17? 🤨🧐

@jotarouchiha5950

2 жыл бұрын

@@izimari yes

I like how speaking counts as stand sound.

Cooom

Man, Jolyne really was Jotaro's only weakness.

I like how casually White Snake just hands Pucci a disc.

I love how he deadass pulled a gun out, and tried to shoot a bird like it was hunting season

0:15 me when home alone

@Rony_15.33

2 жыл бұрын

Anasui exaggeration

@zar1536

2 жыл бұрын

0:33 When you see your parents returning

@imjonathan6745

2 жыл бұрын

Tamud

0:26 me when you're mom is at my house

@goofyahhkokushibou6603

Жыл бұрын

Your*🤓🤓🤓

What a bizarre set occurrences if I do say myself.

I CANT WAIT FOR C MOON TO GET ANIMATED AS WELL

Whitesnake: *angry cgi noises*

@gmelld

2 жыл бұрын

Virgin white snake cgi enjoyer vs average no cgi *Star Platinum*