How NOT To Do A Vaccine PSA (Jimmy Kimmel Fail)

Jimmy Kimmel had a segment featuring some doctors and nurses giving a vaccine public service announcement. It's had a mixed response.
I do really want to make some non-COVID, more produced videos. But I keep finding myself making these sh*tty looking basic low-effort ones to respond to something topical. Just when I thought I was out, they pull me back in.
Original clip: / 1389793339566739460
-----------------
More Medlife Crisis:
www.medlifecrisis.co.uk
/ medcrisis
/ @medlife2
watchnebula.com/medlifecrisis
/ medcrisis
/ medlifecrisis

Пікірлер: 1 900

  • @MedlifeCrisis
    @MedlifeCrisis3 жыл бұрын

    Hey guys. I am an ACTUAL MEDICAL DOCTOR. Look at all my diplomas motherf*ckers! I only bought half from the internet, so you can definitely trust me. NEVERTHELESS, I hope I always make it clear that you shouldn't listen to me, or put any weight in what I say - learn from the experts like I do. When it comes to talking about the pandemic, it's public health doctors and professional science communicators. I try to imbibe as much as I can from them and although it's tempting to vent frustration at wilfully harmful and evil people, you won't catch these professionals acting so...unprofessional.

  • @isyourwifion5384

    @isyourwifion5384

    3 жыл бұрын

    Where do you buy your diplomas? Asking for a friend.

  • @saims.2402

    @saims.2402

    3 жыл бұрын

    You made sure you were first

  • @whatelseison8970

    @whatelseison8970

    3 жыл бұрын

    Ok hot shot. Whip em out!

  • @photonicpizza1466

    @photonicpizza1466

    3 жыл бұрын

    @@isyourwifion5384 Universities sell them for a few hundred thousand dollars, though they're cheaper in Europe. They take quite a while to get delivered, but it's often worth it.

  • @TTillahFK

    @TTillahFK

    3 жыл бұрын

    Get with the program, virtue signalling is important ;)

  • @yuvalne
    @yuvalne3 жыл бұрын

    Saying "I'm so much smarter than you, listen to me" is never a great way to get people to listen to you.

  • @jpe1

    @jpe1

    3 жыл бұрын

    I dunno... Donald Trump, Boris Johnson, Vladimir Putin, Jair Bolsonaro... all men who repeatedly and loudly proclaim that they are the smartest people and have all the answers, and *lots* of people listen to them.

  • @NielMalan

    @NielMalan

    3 жыл бұрын

    @@jpe1 But aren't they saying "don't listen to all those experts with their useless diplomas, listen to common-sense me"?

  • @georgplaz

    @georgplaz

    3 жыл бұрын

    @@jpe1 but they are not doing it in a condescending way towards their crowd. they say "we are so much smarter than they are" and that is a way of keeping your folks, but it creates division. much like the jimmy kimmel clip does. and that is the last thing we need if we want to get everyone vaccinated

  • @erynlasgalen1949

    @erynlasgalen1949

    3 жыл бұрын

    Especially when I am well read and intelligent enough to catch not one but two of my doctors in, if not outright lies, definite misrepresentations. And what does being able to locate the glabella have to do with the potential long term side effects of an experimental vaccine?

  • @MetallicReg

    @MetallicReg

    3 жыл бұрын

    @@erynlasgalen1949 Dunning-Kruger at its best.

  • @georgplaz
    @georgplaz3 жыл бұрын

    People like to convince themselves, that being angry, condescending and snarky is not only appropriate, but even helpful. It is not. If you are calling someone names or showing your middle finger, you are doing it for yourself. Don't fool yourself into thinking this actually helps the discussion. When people are treated like that, they start retreating from you. If they dislike you, it will be harder for them to find their way to admitting you were right, not the other way round. This is as much pointed at Jimmy Kimmel as it is toward the angry youtube comment section. I started rereading everything I post and ask: "Do I want to say this because of me and my frustration, or will it actually help someone change their minds". If its the first, rewrite it, or just let it go!

  • @SchgurmTewehr

    @SchgurmTewehr

    3 жыл бұрын

    Wow! Thank you for reminding me!

  • @famrah

    @famrah

    3 жыл бұрын

  • @TomoyoTatar

    @TomoyoTatar

    3 жыл бұрын

    🐻‍❄️👍❤ true story.

  • @liucyrus22

    @liucyrus22

    3 жыл бұрын

    Thank you. I guess we all have to think if we are just trying to vent or are trying to convince others.

  • @michelle-ve3jb

    @michelle-ve3jb

    3 жыл бұрын

    If you want to be ignorant just say that (Hope you know I'm making fun of them)

  • @virginiaforrest976
    @virginiaforrest9763 жыл бұрын

    I was so horrified when I saw that PSA. As a social worker, I have witnessed first hand the growing distrust people have in medical professionnals and this kind of crap is exactly what got us here in the first place. Being intellectually curious is good actually and doctors and nurses have to get better with communicating with their patients. This sketch implies that a good patient is an obedient one, but fails to recognize that good professionals should be humble, kind and patient.

  • @catone_atelier

    @catone_atelier

    3 жыл бұрын

    Well said. Doctors aren't always right as well. When they don't know for sure they test different medicine on the patient until they see an improvement but that doesn't mean they know what they're doing... So I wouldn't rely on doctors but will listen (with caution) what they say or think it is and analyse the information they have given with further research.

  • @capnskiddies

    @capnskiddies

    3 жыл бұрын

    The maxim of "a good patient is an obedient patient" is precisely the attitude that the generally anti-vax, the anti-covid-vax, or the anti covid restrictions crowds are absolutely railing against. It just sends them off and adds fuel to the fire. I say this as someone cautiously anti-covid vax, but otherwise pro vax. I see these types in Telegram groups.

  • @PatrikKron

    @PatrikKron

    3 жыл бұрын

    I have multiple times come to a doctor a bit sceptical but open to be convinced by reasoning about risks and benefits of a certain procedure. But come out with the conclusion that I don’t trust the doctor at all due to their condescending downplaying of risks and/or rude behaviour.

  • @PatrikKron

    @PatrikKron

    3 жыл бұрын

    @@capnskiddies I see this in myself. I feel that I’m becoming more sceptical too the vaccine when the side effects are downplayed. I would still take any of the covid vaccines that are said to be available for my age group, if I got the opportunity today (although not all of the covid vaccines in general). But if side effects keep being downplayed, I’ll keep getting more sceptical towards it (probably not past the tipping point for all covid vaccines though).

  • @Rosie-xg5pi

    @Rosie-xg5pi

    3 жыл бұрын

    This, this, this. This is exactly why it sat badly with me. If your argument is all doctors are all-knowing geniuses then all it takes is 1 doctor making 1 mistake (which they do all the time) for your argument to be disproved

  • @loremipsum7ac
    @loremipsum7ac3 жыл бұрын

    "Advice Is Like Snow - The Softer It Falls, the Longer It Dwells Upon, and the Deeper It Sinks Into the Mind" Samuel Coleridge (or Jeremiah Seed)

  • @MedlifeCrisis

    @MedlifeCrisis

    3 жыл бұрын

    Nice quote, new one to me :)

  • @DrTssha

    @DrTssha

    3 жыл бұрын

    Likely Jeremiah Seed. Link to source: quoteinvestigator.com/2017/10/17/advice-snow/

  • @benmerzouk9737

    @benmerzouk9737

    2 жыл бұрын

    Jeremiah Seed must never have seen snow then.

  • @thornprick2645

    @thornprick2645

    2 жыл бұрын

    @@benmerzouk9737 HAHA I liked the quote but this didn't even register until you said that

  • @B4K4xNi

    @B4K4xNi

    2 жыл бұрын

    That is NOT how snow works

  • @osakablinladen
    @osakablinladen3 жыл бұрын

    >can he point to his glabella ah yes the body part most crucial to understanding how vaccines work

  • @MedlifeCrisis

    @MedlifeCrisis

    3 жыл бұрын

    Dunno about you but I insisted they inject my vaccine directly between my eyes. I don't want eye COVID.

  • @Am_Yeff

    @Am_Yeff

    3 жыл бұрын

    @@MedlifeCrisis eye covid has a mortality of 100%! Could be something about how the cure involves a hammer but still!

  • @juanje99

    @juanje99

    3 жыл бұрын

    @@MedlifeCrisis did it... Did it open your third eye, doc? Can you now see the end?

  • @foggyfrogy

    @foggyfrogy

    3 жыл бұрын

    Do they really think people listen to this and think ,,ohh my whole life was a lie, I was wrong, I'm going to get vaccinated right now"

  • @liucyrus22

    @liucyrus22

    3 жыл бұрын

    Yeah that is a strawman argument. Attacking the weakest link of one of the weaker counter argument discredits the counter but won’t make them more convincing.

  • @MrTrilbe
    @MrTrilbe3 жыл бұрын

    "my field has a reputation with impatience", well yeah I don't think you'd have much time with outpatience... well that was a cheap shot dad joke, i'll go hide in a corner now

  • @xmlthegreat

    @xmlthegreat

    3 жыл бұрын

    You.. I like you!

  • @abdul-rahimdahman3300

    @abdul-rahimdahman3300

    3 жыл бұрын

    Imma borrow that next time I work with an internal medicine specialist xD

  • @AndrewBlucher

    @AndrewBlucher

    3 жыл бұрын

    There can never be enough Dad jokes.

  • @feliciabarker9210

    @feliciabarker9210

    3 жыл бұрын

    I honestly thought Rohin was going to make that joke himself

  • @bloodypommelstudios7144

    @bloodypommelstudios7144

    3 жыл бұрын

    I was going to thumb your comment up but it's on 666.

  • @sonofCW
    @sonofCW3 жыл бұрын

    I'm a teacher, and the "I'm smarter than you, so shut up and listen" always works and I'm well respected for it #heavyheavysarcasm

  • @PinHeadSupliciumwtf

    @PinHeadSupliciumwtf

    3 жыл бұрын

    @@deadwendy6870 more like #heavyheavyscam :P

  • @ta8689

    @ta8689

    3 жыл бұрын

    the kids in a classroom would eat you alive :D

  • @pranavagrawal9382

    @pranavagrawal9382

    2 жыл бұрын

    Laughs in military dictator

  • @spvillano

    @spvillano

    2 жыл бұрын

    That didn't even dent my sarcasometer. A little more work and you can blow that meter out. No problem, got a shelf full of them, as I'm incessantly blowing them out and get them by the pallet. ;) But hey, I got the vaccine. No orthopoxvirus can infect me now! No, there is no such thing as a wrong vaccine. Only an incorrect application. :P

  • @ordinarryalien

    @ordinarryalien

    5 ай бұрын

    Is this a sarcasm?

  • @_JoyceArt
    @_JoyceArt3 жыл бұрын

    What I found especially annoying about that “psa”, was that trained specialists found the need to ridicule irrelevant characteristics to bring their point across. Like for instance “believe the post of your aunt on Facebook, that still makes dollhouses”. As if someone’s hobby discredits their opinion. Someone’s potentially harmful opinion is what discredits it itself. The overall snarky and arrogant tone was off-putting, even to me, a round-earther, pro-vaxxer, mask wearing, physically distanced working from homer. This displayed all the presumptions that people have about medical professionals : The ones not listening to patients with a god complex. (No, I don’t make dollhouses).

  • @LeavingGoose046

    @LeavingGoose046

    2 жыл бұрын

    Dollhouses do be kinda cool though ngl

  • @warbler1984

    @warbler1984

    2 жыл бұрын

    @@LeavingGoose046 plus they're actually worth a lot

  • @_JoyceArt

    @_JoyceArt

    2 жыл бұрын

    @@LeavingGoose046 dollhouses definitely are really cool, in fact, everything someone makes from scratch or even builds from kits is great. I consider myself a maker of things, so it irked me that much.

  • @spvillano

    @spvillano

    2 жыл бұрын

    @@_JoyceArt I dunno, I've made my share of messes, nobody ever wanted to buy one. Oil paintings, yes, jewelry, yes, the mess made while making those, not so much. ;)

  • @AnaLucia-wy2ii

    @AnaLucia-wy2ii

    Жыл бұрын

    Not that there’s anything wrong with that!!!

  • @ergesilva
    @ergesilva3 жыл бұрын

    An important issue with the segment is that there are also antivax with qualifications. So if you move the discussion to that side, there is always some guy with diplomas providing some respectability to any nonsense.

  • @MedlifeCrisis

    @MedlifeCrisis

    3 жыл бұрын

    Very good point. Breaks my heart when medically qualified people start talking nonsense - not just about vaccines) and it's alarmingly common.

  • @seberdee8824

    @seberdee8824

    3 жыл бұрын

    and also when someone just assumes that as they have more qualifications that as a patient you have no right to an opinion or point of view

  • @sarahcb3142

    @sarahcb3142

    3 жыл бұрын

    Good point. This is why ending an argument with a simple appeal to authority doesn't work. Obviously, it's much more likely for something to be true if the vast majority of experts in that field say it's is, but not always. We should never just accept things at face value because someone with a degree or position of power tells us to.

  • @seberdee8824

    @seberdee8824

    3 жыл бұрын

    @@sarahcb3142 I completely agree ,just had an argument with my cardio as she has a qualification and i dont ,she didnt want to run another test because she cant be wrong and im not a doctor but guess what when the test was run i was right and she was wrong having qualifications doesnt make you infallible,you should still be open to suggestions.You need to be intelligent enough to understand that you cant always be right !

  • @stellam5872

    @stellam5872

    3 жыл бұрын

    Good point! Overall, I feel like qualifications make a person far more likely to be right compared to a non-qualified person, but that doesn't mean they're ALWAYS right -- expert or not, they should still be able to fully explain their claims and back them with solid evidence.

  • @yash8055
    @yash80553 жыл бұрын

    KZread and all social media is a attention economy than a fact based economy.😔

  • @MedlifeCrisis

    @MedlifeCrisis

    3 жыл бұрын

    DON'T FORGET TO SMASH THAT LIKE BUTTON

  • @yash8055

    @yash8055

    3 жыл бұрын

    @@MedlifeCrisis yes 😁

  • @thorvaldspear

    @thorvaldspear

    3 жыл бұрын

    @@MedlifeCrisis lmao

  • @fluxmind

    @fluxmind

    3 жыл бұрын

    @@MedlifeCrisis Did you just give a comedy workshop to comedians at Jimmy Kimmel?

  • @ExplosiveBolts

    @ExplosiveBolts

    3 жыл бұрын

    This, it's narcissism fuel.

  • @danthesandman
    @danthesandman3 жыл бұрын

    "If you want to lose a war first make an enemy." Making people hate you for insulting them is the perfect way to make sure they will do all they can to disagree with you.

  • @joyfisher8008
    @joyfisher80083 жыл бұрын

    I went to a doc who decided to remove a mole immediately. I didn't know the procedure & said I'd eaten breakfast, thinking general anesthesia was coming. She started ridiculing my ignorance. I mentioned it to head of practice who said there'd been other complaints & she wasn't w/ the practice very long.

  • @capnskiddies

    @capnskiddies

    3 жыл бұрын

    I'd take a poor "bedside manner" for a quick job done. I had to wait a year and a half to have one removed. Though my surgeon was a cutie & a flirt.

  • @KattReen

    @KattReen

    3 жыл бұрын

    I have a potentially unpopular opinion on this, but I feel like this might be more common from female practicioners towards female patients. I can't know if this happens to male patients too obviously, but my experience when it comes to more overt disrespect it's surprisingly not coming from male doctors or nurses. Some of the nicest and professional people I've come across have of course ALSO been women, it's just interesting that most of the sexism and disrespect I've experienced coming from medical professionals has been pretty overwhelmingly coming from women, even though there has been a pretty even gender divide, excluding gynecology(where all the doctors and nurses are angels anyways for some reason).

  • @derekwheeler4299

    @derekwheeler4299

    3 жыл бұрын

    That happens to me when they ask if I'm allergic to anything and I tell them bees.

  • @osakablinladen

    @osakablinladen

    3 жыл бұрын

    @@KattReen i think it's female practicioners in general not just towards females

  • @ml5444

    @ml5444

    3 жыл бұрын

    There are a lot of asshole doctors. It's pretty surprising.

  • @2ToneWalt
    @2ToneWalt3 жыл бұрын

    Suffering from cardiomyopathy and arrhythmia and nearly dying a couple of times I am grateful for what you and your colleagues do, that being said. Your wife's right about the shirt.

  • @willtowers1532

    @willtowers1532

    2 жыл бұрын

    big up MrSteve keep on shwinning

  • @KianMayne
    @KianMayne3 жыл бұрын

    Criticising humour is always a difficult line to walk (nobody likes the fun police) but I think the text at the end hits the nail on the head. The problem is that these people were real doctors and they're ultimately talking about being frustrated with their patients. It's the same issue as when you had the doctors/nurses on TikTok complaining about patients last year - it damages trust

  • @Anon.G

    @Anon.G

    3 жыл бұрын

    Got something to be humour it needs to be funny, and many people don't believe SNL to be funny

  • @mjbakermd414

    @mjbakermd414

    3 жыл бұрын

    Doctors = People too. But I get it, doctors should put themselves above the masses at least when they have their uniform on.

  • @Anon.G

    @Anon.G

    3 жыл бұрын

    @@mjbakermd414 If you are going to say that people should listen to you because of your authority, you need to act like you deserve the authority.

  • @NA-yq4pe

    @NA-yq4pe

    3 жыл бұрын

    I think it's fine for doctors to make jokes about their patients - but only with colleagues and others who are in the field, or privately with family & friends. Doing it in front of such a big audience where many people could misinterpret it is just a really dumb idea.

  • @lolasonner5051

    @lolasonner5051

    2 жыл бұрын

    Exactly it also makes doctors look like look like opinionated , unsympathetic and unapproachable assholes and if you want to convert someone who is vaccine hesitant this is not the way to go about it. Infact it's probably the best way to make people not approach a doctor with any concerns they may have about getting vaccinated.

  • @matekis4444
    @matekis44443 жыл бұрын

    That Kimmel bit made me legitimately cringe. One of the first things we're taught in medical communication seminars (which are within our first year of studies in Hungary) is _never_ to condescend. It will invariably turn the patient against you (rightfully so, to be honest) and reduce compliance. If I used the sort of language the people in the Kimmel skit were, I wouldn't make it past year 1 of medical school, let alone get a degree. Thanks for drawing my attention to this. Might share it among my peers; after all, a great example of how to do things the wrong way can be just as useful as an example of how to do things the right way.

  • @emiki6

    @emiki6

    2 жыл бұрын

    Van még egy érdekes jelenség. Az, hogy annyit kell tanulni az orvosin, hogy tudat alatt az orvos meggyőződésévé válik, hogy annyi mindent tud már, hogy mindent tud. Szóval őrizzétek meg a nyitottságotok, kíváncsiságotok és a lelkesedést! Lássátok meg a kihívást a szokatlan esetekben. Én amúgy ha dokinál (vagy más szakértőnél) járok, akkor mindig próbálok érdeklődni, hogy mit miért vizsgál stb, hogy szerezzek némi rálátást a dologra, értsem. Sajnos sok doki mintha egy falat húzna maga elé, nem akar "tanítani", nem akarja bevonni a pácienst a probléma megoldásába, pedig a dokiba vetett bizalmat erősítené, ha bevonná. Mondjuk lehet hogy a legtöbb beteg nem is akar részt venni a kezelésében, csak passzívan elszenvedni és az orvosok csak belefásulnak ebbe.

  • @matekis4444

    @matekis4444

    2 жыл бұрын

    @@emiki6 A te hozzáállásod kéne legyen az alap, és bár nem lep meg, őszintén csalódást keltő azt hallani, hogy a dokik a tapasztalataid alapján nem nagyon hajlandóak bevonni a kezelésbe. Azok alapján, amiket eddig tanultam, a gyógyítás legjobban akkor működik, ha az orvos-beteg kapcsolat partneri, nem paternalisztikus. Én a több száz éves eddigi hozzáállást hibáztatom ezért, amivel a társadalom rendelkezett, hogy márpedig az orvos szava az első és megkérdőjelezhetetlen. Meg azt hibáztatom, hogy ezt még nem sikerült kinőnünk, és sok mostani orvos (ezúton is tisztelet a számos kivételnek) aktívan beleélte magát ebbe a szerepbe. És hiába tanítják már ennek az ellenkezőjét aktívan, olyan hosszú az oktatási folyamat, hogy akár évtizedek telhetnek el, amíg a régi gárda átadja nekünk a stafétát, és addig ez a fennállás fog maradni. De az is biztos, hogy mielőtt ezt megteszik a mostani orvosok, sokan fogják az elavult nézeteiket, világlátásukat ráerőltetni az újoncokra, akik pedig (lévén alapvetően már kiégve, önbecsülésüket a sorozatos bukások és traumák által lerombolva kezdik a pályafutásukat), inkább hallgatni fognak rájuk, mintsem ellentmondjanak a szakorvosnak. Én magamról csak remélni tudom, hogy amikor kikerülök az egészségügybe, nem esek ebbe a hibába. És remélem, a társaim hasonlóképp tesznek. ...Majd az idő lesz ennek a megmondhatója.

  • @WhyHelloShelby
    @WhyHelloShelby3 жыл бұрын

    A lot of people are afraid to bring things up to the doctor in fear of sounding stupid even though it's something quite concerning to them. I think this bit could grow that fear in someone and that can absolutely lead to bad outcomes.

  • @MeowcorePodcast
    @MeowcorePodcast3 жыл бұрын

    "Would being nice and civil convince anti-vaxers?" Don't they realise that the good way to convince people is by being nice and civil? It's nice and civil people that convinced me. I was an anti-vaxer.

  • @greatspaceadventure

    @greatspaceadventure

    3 жыл бұрын

    What convinced you?

  • @MeowcorePodcast

    @MeowcorePodcast

    3 жыл бұрын

    @@greatspaceadventure The ex-Christian podcasts I listened to, and my best friend. None of them was condescending.

  • @lydiacopes5687

    @lydiacopes5687

    3 жыл бұрын

    Thanks for sharing your experience, being willing to share your personal experience, especially with someone you know, has also been shown to be more effective at changing minds.... unlike, you know, strangers yelling facts at you on TV 🤦🏼‍♀️

  • @blackmber

    @blackmber

    3 жыл бұрын

    Yeah and dismissing your concerns by saying “I know more than you” probably wasn’t a part of those conversations. I actually watched a video about the anti-vax movement that claimed allergic reactions to vaccines don’t exist. I’m no expert, but various sources tell me they do happen, though rarely. Shooting down a sincere question like that is alienating. Discussing the legitimacy of both the risks of taking or not taking a vaccine is a much better approach.

  • @diegoteixeira2003

    @diegoteixeira2003

    3 жыл бұрын

    @@MeowcorePodcast That's the reason flat earther keep believing in flat earth. Because most people are condescending to them.

  • @sarahcb3142
    @sarahcb31423 жыл бұрын

    The reason why I love your channel is that you bring up ethical issues in the medical field that "entertainers" will not. They're not always fun to talk about, even if it is extremely eye opening and informative. And talking about things in a nuanced/non-patronizing way certainly won't get you clicks. So I just wanted to say I really appreciate your candid opinions and informative format! Edit: I should clarify that you're entertaining and funny as well! But since that doesn't override your message I view your channel as more of an educational than an entertainment one.

  • @junipertree2601
    @junipertree26013 жыл бұрын

    Why would I let someone who actively and publicly despises me make healthcare decisions for me?

  • @Ruby_V_
    @Ruby_V_3 жыл бұрын

    Regarding prioritization, I personally prefer your content that teaches about the 'lies hiding in plain sight'. It's easy for me to research and get a basic understanding why an alternative medicine claim is groundless, but subtler things like full body scans are much harder for me as a non-expert to identify and deconstruct on my own. I appreciate that kind of critical thinking much more from you, as you are unusually skilled at it from my perspective.

  • @MrMartinNeumann

    @MrMartinNeumann

    3 жыл бұрын

    Also, there are already plenty of content creators making fun of quackery.

  • @CuriousDoc
    @CuriousDoc3 жыл бұрын

    Agreed, there needs to a distinction between comedy and factual information otherwise the truth is obscured and people don't know what to believe. What ticks me off is the condescension and, frankly, I'm surprised the doctors and nurses in the video agreed to that

  • @davidthomas9960

    @davidthomas9960

    3 жыл бұрын

    The problem with US late night comedy is that it doesn’t care about facts or even comedy, it’s entire purpose is to tell everyone in the audience that what they believe is infallible and everyone who believes anything different is an idiot. And they all lap it up and clap along like idiotic seals

  • @seraphina985

    @seraphina985

    3 жыл бұрын

    To be fair some really good comedians can pull off a fairly effective deconstruction of bad ideas in a way that does mix comedy with a form of argument that they manage to smuggle past that initial "La la la I'm not listening" reaction. Mostly this works because they play off the absurd to the point of being comedic implications of the flawed idea itself rather than going after the people holding that belief. As an example of a better way to mix argument with comedy check out "George Carlin on Religion and God" it's here on youtube. Note how he doesn't directly attack the believer but rather goes after the absurdities and contradictions of the bad ideas being promoted albeit with comedic emphasis and exaggeration. The example clip in this video was a bunch of ad hominems and other useless nonarguments that are never going to get anyone thinking whether expressed comedically or not.

  • @gregdesouza17

    @gregdesouza17

    3 жыл бұрын

    While medicine is an important field, medicine is not devoid of fucking twats. By being a celebrated field, it actually attracts some portion of narcissists that don't actually care about people, but do care about the status of the profession.

  • @littlered6340

    @littlered6340

    3 жыл бұрын

    The thing I always find myself remembering white watching Jimmy Kimmel is that the show is very good at finding the right people to participate in bits. Whether it's Americans who somehow forgot the pledge of allegiance despite having it crammed down our throats from childhood, or doctors willing to look absolutely terrible on late night television. Somehow they always find enough for the bit. I used to love the show, but I will admit that the loose threads have been ruining the sweater for me. (Is this a real metaphor? I typed loose threads and then just kept going, hopefully it makes sense.)

  • @0Clewi0

    @0Clewi0

    3 жыл бұрын

    @@littlered6340 Or people that can't even point to the US is a world map. The biggest problem with late night comedy is that it ended up being the same as the 24 hours news cycle they were parodying, reaching the low hanging fruit to produce content quickly and just end up being the same as the dozen other of similar shows.

  • @aukofx6393
    @aukofx63933 жыл бұрын

    I just got my first round of moderna the other day and the doc said "so you're ready for your first bit of alien dna?"

  • @chriswright9096

    @chriswright9096

    3 жыл бұрын

    Awww....and you were hoping you were going to get the one with the Bill Gates microchip in :)

  • @aukofx6393

    @aukofx6393

    3 жыл бұрын

    @@chriswright9096 I told him I was ready for the upgrade to Autism Premium and he really tried not to laugh but couldn't help it

  • @sophierobinson2738

    @sophierobinson2738

    3 жыл бұрын

    I once had a doctor with a sense of humor. He moved his practice closer to his home, and have yet to find one like him. I have a primary care physician that I haven't been face to face with in 4 years. Always a CNP.

  • @ThirrinDiamond

    @ThirrinDiamond

    2 жыл бұрын

    @@aukofx6393 haaaaahahhahahahaha

  • @labdulekrem

    @labdulekrem

    2 жыл бұрын

    he is probably right

  • @patrioticcookie1207
    @patrioticcookie12073 жыл бұрын

    Actually I'm really happy with the fact that you kept saying "I don't know." It's fine to not always know the right answer, and pretending you do can lead to more harm than good.

  • @NA-yq4pe

    @NA-yq4pe

    3 жыл бұрын

    There's also the other side though where many science sceptics don't believe people exactly because they don't have an answer to everything, they'd rather believe someone who pretends to know it all

  • @creativedesignation7880

    @creativedesignation7880

    3 жыл бұрын

    @@NA-yq4pe Sadly not everyone understands the difference between truth and knowledge, but I think we would be going down the wrong road, if we tried to pander to them. Misunderstandings like the idea that a scientist, who does not know everything, is a bad scientist should be cleared up rather then built upon.

  • @PatrikKron

    @PatrikKron

    3 жыл бұрын

    @@NA-yq4pe I do believe, but I have nothing to back it up, that there are more people that put trust in people who don’t know everything and are open about it, than people that claim to know everything.

  • @kissarococo2459

    @kissarococo2459

    3 жыл бұрын

    @@NA-yq4pe and many scientists who have argued for thalidome, electric shock therapy dfor autists and lobotomy.... (I'm not a science-denier btw.)

  • @LeavingGoose046

    @LeavingGoose046

    2 жыл бұрын

    If the CDC and other health organizations claimed ignorance rather than had their message be treated as the words of God descending from the high heavens, I guarantee more people would trust them after their message changed. It was because their word was infallible while constantly in flux that helped create the mess we're in now.

  • @shade9592
    @shade95923 жыл бұрын

    If they got people like Jason Leong or Ken Jeong to do a bit like this.... I think it could work to some extent, if they allowed them write their own lines. It could be more effective and would definitely be much funnier but it would also be more expensive.

  • @MedlifeCrisis

    @MedlifeCrisis

    3 жыл бұрын

    Great shout. Both have a freedom as they're no longer practicing and can say what many of us may WANT to, but shouldn't.

  • @MedlifeCrisis

    @MedlifeCrisis

    3 жыл бұрын

    @@racitup4114 I went to the same medical school as him!

  • @ARTiculations
    @ARTiculations3 жыл бұрын

    Rohin I just wanna say I’m thankful for you.

  • @dinogoldie9716
    @dinogoldie97163 жыл бұрын

    I don't listen to experts. I listen to expertise. The punditsphere enjoys playing appeal-to-authority switcharoos: "We should listen to him about X because he has a doctorate in Y...She's made a lot of money doing X so clearly she's an authority on Y..."

  • @vhs3760
    @vhs37603 жыл бұрын

    you saying 'I don't know' is much more informative to me than the average person trying to list off facts that fit their narrative. thank you for another wonderful video.

  • @syriuszb8611
    @syriuszb86113 жыл бұрын

    I think I have read about the study about how to convince people, especially those believing in whacky theories. And being patronizing was one of the worst thing to do.

  • @btonasse

    @btonasse

    3 жыл бұрын

    Manipulative might be more effective, but is it any better?

  • @genessab

    @genessab

    3 жыл бұрын

    @@btonasse how about being sincere and empathetic? Why are the only two choices manipulative or patronizing?

  • @damianpos8832

    @damianpos8832

    3 жыл бұрын

    @@btonasse Road to Hell is tiled with good "intentions"... and you have just added one more tile...Instead of transparency, free choice and risk-benefit analysis,You are advocated for the government to lie and manipulate its own populations?

  • @btonasse

    @btonasse

    3 жыл бұрын

    "Shut up and listen to science" is the epitome of sincerity in my book.

  • @syriuszb8611

    @syriuszb8611

    3 жыл бұрын

    @@genessab It is very difficult to be empathetic when you see people accusing doctors and scientists of being literally Satan and in same time they promote dangerous ideas, that kill people right now. Fight with the ignorance is very frustrating.

  • @gkcadadr
    @gkcadadr3 жыл бұрын

    There absolutely are "floating votes" and a down to earth expert or someone they deem to be more knowledgeable speaking directly to them without dehumanising them is totally effective. It's never the flick of a switch but every seed matters. Insulting them and patronising them *is* a flick of a switch tho, you'll lose them immediately and there's no undo button.

  • @rachelatwood9555

    @rachelatwood9555

    3 жыл бұрын

    totally. One good place to start is explaining how the vaccines work using basic language, and use a measured, respectful tone when you answer skeptics' questions, no matter how crazy they sound. This reminds me of a recent story about a Republican congressman from Orange County who asked an epidemiologist on live TV if there was any way the COVID vaccine could contain a tracking device---not because he believed the conspiracy theory about trackers in the vax, but he knew at least some of his constituents had bought into that madness. Lots of people are badly misinformed, but not necessarily stupid--sometimes you have to meet them where they are if you want to see any real progress.

  • @LB-sl8fw

    @LB-sl8fw

    3 жыл бұрын

    This American Life also recently put out an episode on this issue called "The Herd", where they followed a focus group of vaccine-sceptical Republican Trump voters and explored different ways of changing their opinion. At the end of the meeting I think all of them leaned more towards getting the vaccine and (spoiler!) making fun of them or calling them dumb asses wasn't one of the ways that made them change their minds

  • @TesterAnimal1

    @TesterAnimal1

    3 жыл бұрын

    It’s a sad state when anybody being fucking TOLD anything just gets to spout “condescending”, and that’s that. World’s fucked. Just demolish the universities. Let’s go back to banging fucking rocks together.

  • @kennethg9277

    @kennethg9277

    3 жыл бұрын

    @@TesterAnimal1 there won't be anyone left to bang rocks together! But I think you're right that it's inevitable

  • @gkcadadr

    @gkcadadr

    3 жыл бұрын

    @@TesterAnimal1 I mean, this is a textbook example of what I'm trying to say. What you say is not wrong, you've merit, but you put it out there in such a way that if you'd said 2+2=4, I'd feel the urge to disagree just out of spite. You might be rightly mad at people, but there's no Planet Annoyed Scientist one can go and settle, so it's onto us to make this wet one a less insufferable. Does it get really old real quick? It does, and as a(n upcoming) linguist I'd love to punch the next person that says something like "splitting infinitives is bad grammar" out of consciousness, but it just doesn't work that way, unfortunately.

  • @tamara3984
    @tamara39843 жыл бұрын

    Quote from my GP: "you know more about your condition than I".

  • @sarahcb3142

    @sarahcb3142

    3 жыл бұрын

    And that's often the case! Especially if it's a rare condition. There's just so many different conditions out there and bodies that react differently to each condition that there's no way a general practitioner could be an expert in everything. Obviously that doesn't mean they don't know what they're doing, but it's a good GP that can realize an invested patient may know things about their specific situation that a GP doesn't.

  • @tamara3984

    @tamara3984

    3 жыл бұрын

    @Nicky L they discharge me after the first meeting as they can't help me. I tend to have to start each visit with 'I know you can't help me, but I need this for the insurance'. I once had a consultant, that was so downtrodden, I really wanted to hug him. Poor guy, very young too. I have scared a few medical professionals in my life. Feel always sorry for them. Having a less known condition isn't fun for any party involved. Doctors are just human and can only do their best, but for some that gap from what they know to what they need to know to deal with me is huge.

  • @daniel-zh9nj6yn6y

    @daniel-zh9nj6yn6y

    3 жыл бұрын

    Doctor: You have a rare condition. Patient: What is its name ? Doctor: What do you want it to be ?

  • @drhmufti

    @drhmufti

    2 жыл бұрын

    My Expert patients often know their conditions better than Specialists and Generalists.

  • @TheChesnutCafe
    @TheChesnutCafe3 жыл бұрын

    You mentioned the idea of doing a video on corruption among medical professionals and researchers. Could you do a video on excited delirium and taser companies paying their pet doctors to deny that tasers have caused a fatality? As a cardiac surgeon I assume you would have some insight into how dangerous tasers are.

  • @saims.2402
    @saims.24023 жыл бұрын

    That tiny red dot 🔴 in the top right corner was triggering me.

  • @usernamesoldout

    @usernamesoldout

    3 жыл бұрын

    Sniper

  • @MedlifeCrisis

    @MedlifeCrisis

    3 жыл бұрын

    Haha I was going to make a sniper joke but forgot. It's something in the camera unfortunately (this was my old one). CCD might be buggered.

  • @GodBlade132

    @GodBlade132

    3 жыл бұрын

    And now I can't unsee it. Thanks.

  • @edc1569

    @edc1569

    3 жыл бұрын

    @@MedlifeCrisis been filming in the radiotherapy room?

  • @CED99

    @CED99

    3 жыл бұрын

    @@edc1569 excellent idea - this camera is now the radiotherapy camera. Yes the CCD is buggered Rohin

  • @Roll587
    @Roll5873 жыл бұрын

    Thank you, Dr. Francis. Your channel is always enlightening and I appreciate all of your work.

  • @ariw9405
    @ariw94052 жыл бұрын

    I agree as someone who had no problem getting the vaccine so allegedly this would be “my crowd” I had 2nd hand embarrassment for the medical professionals in this skit. They really did come across as smug and arrogant with no chance of encouraging change.

  • @sauvanto9316
    @sauvanto93163 жыл бұрын

    Right on! Insulting your audience is THE worst way to get a message through; we see here again an example that intelligence, education and judgment are 3 completely separate thing. Pretty poor judgment on their end to call their patients uneducated idiots... Thanks Rohin for sharing this!

  • @Shorty24136
    @Shorty241363 жыл бұрын

    As someone with a severe needle phobia this whole situation with vaccination has been difficult. I see the value of vaccination and encourage my friends and family to be vaccinated however there have been people who have tossed me into the anti-vax basket and had such vitriol towards me. It honestly scares me that there are many comments over social media saying people should be pinned down and forced vaccinated or be thrown in jail for not willing to be vaccinated. The medical community scares me (irrationally) but saying things like grow the f up and get your vaccination in no way helps... just makes me feel like shit and pushes me away more... Thankfully there are doctors who are willing to understand and take time - unfortunately this type of 'humour' undermines them.

  • @liucyrus22

    @liucyrus22

    3 жыл бұрын

    I think they are trying to vent or makes a scapegoat out of you for all the suffering they faced under unnecessarily hard COVID policies. “We can’t have good things because of anti-vaxxers!” They want a scapegoat. They don’t want a solution.

  • @emil1063

    @emil1063

    3 жыл бұрын

    I'm so sorry you've had to endure all that. Needle phobia is relatively common too, and at least at the vax clinics (in the US) where I've been volunteering we're trained to be sensitive to that fact and to tailor our patient interactions accordingly - with doctors, nurses, and often also mental health workers on site to provide any professional support the patients might need, and naturally paramedics on hand in case of emergency. Thanks for continuing to encourage others to get vaccinated, and I hope that you find similar care if/when you go for your vaccine. But I can imagine that none of that amounts to much if people are deterred from coming in the first place by condescension and cruelty on social media.

  • @bdf2718

    @bdf2718

    3 жыл бұрын

    The solution to needle phobia is simple. Before they vaccinate you, get them to inject you with a general anaesthetic so you're unconscious when they vaccinate you.

  • @Shorty24136

    @Shorty24136

    3 жыл бұрын

    @@emil1063 personally I have found it difficult to coordinate different medical staff (psychologists and whom ever is administering said needle) from what I understand it is a bit easier (however more costly) in the US rather than Australia where I am. Thankfully in regards to covid the town I am in has had a total of something like three cases and they were many many months ago (near the beginning of all this). Thank you for your support and understanding it means so much. I don't know if you have had a look but Needlephobia.com is a fantastic resource and may help you when someone comes in. Xx

  • @Shorty24136

    @Shorty24136

    3 жыл бұрын

    @@bdf2718 not as crazy as it sounds only needle I have since 2011 was under g/a I was put under with gas 🤷‍♀️

  • @vicccccctorrrrrrrrrr2670
    @vicccccctorrrrrrrrrr26703 жыл бұрын

    Hey, you‘re just a fantastic person! I‘m very impressed by your hard work as a medic and youtuber. Thank you for educating me and many more, also with your impeccable English. Love from Luxemburg!

  • @HisameArtwork

    @HisameArtwork

    3 жыл бұрын

    here here!

  • @user-jc1xl5lj1t

    @user-jc1xl5lj1t

    3 жыл бұрын

    What's his first language?

  • @vicccccctorrrrrrrrrr2670

    @vicccccctorrrrrrrrrr2670

    3 жыл бұрын

    Mine? Or the guy who commented „here here“? I assume his first language is not English, but I don‘t know for sure. In case you‘re asking about mine, it‘s german.

  • @user-jc1xl5lj1t

    @user-jc1xl5lj1t

    3 жыл бұрын

    @@vicccccctorrrrrrrrrr2670 Oh I was asking if the doctor here learned English as a second language since you complimented his English. If it's his first language though you could just say he's eloquent/well-spoken--no need to specify that he has good English because that makes it sound like he's not a native. Guden Tag! :D

  • @caKravartin9
    @caKravartin93 жыл бұрын

    These late-night people are so cringeworthy, that it's almost physically painful.

  • @STOPjammietime
    @STOPjammietime3 жыл бұрын

    As a lifelong lefty, I've started to really be unable to watch most of the late night shows. They're just so smug and condescending towards anyone who thinks differently and it's frankly uncomfortable to watch. It's just a circle-jerk, doing no good whatsoever, except the hosts making a mint and the people getting a cheap laugh from pointing the finger at those they consider to be intellectually inferior.

  • @Youre-Welcome

    @Youre-Welcome

    2 жыл бұрын

    Lol you think late night TV isn't leftist??? 🤣🤣🤣🤣

  • @jaustin97601

    @jaustin97601

    2 жыл бұрын

    @@Youre-Welcome there's a big difference between leftists and liberals. Late night TV is liberal, not leftist.

  • @Sivah_Akash
    @Sivah_Akash3 жыл бұрын

    Basically don't shame those who are in the "wrong". It just pushes them to defend themselves unconsiously. If no patience, just leaving it alone is better for the sanity of both parties and for future engagement.

  • @Pastor_Madeline
    @Pastor_Madeline3 жыл бұрын

    Either your shirt collar has drastically lost it’s elasticity or you’ve found a shirt with the intent of exposing chest hair 😉...we gotta know Doc!!

  • @deepakrajendra8019

    @deepakrajendra8019

    3 жыл бұрын

    Read the text at the start of the video

  • @Pastor_Madeline

    @Pastor_Madeline

    3 жыл бұрын

    @@deepakrajendra8019 🤣🤣🤣

  • @Tr1sh4Lynn

    @Tr1sh4Lynn

    3 жыл бұрын

    ARGH. I hate that pausing or rewatching to get a joke has become a THING on YT. Down with this sort of thing!

  • @jensgoerke3819
    @jensgoerke38193 жыл бұрын

    Barely surviving measles was a nasty experience, half a year later I could have been vaccinated. Oh well, I'm already on the waiting list.

  • @cirrusfloccus6080
    @cirrusfloccus60803 жыл бұрын

    So, I've been in the medical system for my entire life (as a patient) and a doctor telling me that I am dumb and he knows better and I should just listen to him is a sure way to make me listen to someone else. Since I still believe in doctors, in all cases that 'someone else' will be another doctor who will treat me like an actual human being with a brain. I have the capability to understand why I should do certain things, but if the only argument a doctor has for me is "it will help, trust me, I studied this", I sure as hell will not trust him. I mean, if it's just some random thing that will not hurt me, I'll probably try it, but most times it's pills or a doctor telling you there's actually nothing wrong with you and you should just visit a psychologist, even though you've been feeling miserable for an entire year and then you figure out that you're actually just lactose intolerant...

  • @adid.8526

    @adid.8526

    3 жыл бұрын

    Well it's actually the truth that the doctor studied the issue far longer than a patient. But I think a good lesson for any practitioner is "the patient knows his disease better than you do". All the nights and days spent reading and stressing out over exams is worthless if you can't have the empathy to use that knowledge to help. And many times, taking a good listen to the patient can actually provide you with the answer. After all, the patient is there because he is in pain, scared and needs help, not because he wants to challenge you or prove anything...

  • @SecretSquirrelProduc
    @SecretSquirrelProduc3 жыл бұрын

    Dont mind me, just feeding the algorithm..

  • @Gtx-ij9ff
    @Gtx-ij9ff3 жыл бұрын

    "Flat earthers are unlikely to cause themselves harm" Remember that guy that strapped himself to a homemade rocket?

  • @MedlifeCrisis

    @MedlifeCrisis

    3 жыл бұрын

    I did indeed think of him, which is why I think I added in a "in significant numbers" to the end of the sentence!

  • @mjowsey

    @mjowsey

    3 жыл бұрын

    Yeah, mad Mike or something, I don't think has was really an FE believer. He got a bit of funding by pretending to be FE, they were the only group daft enough to think he was doing something that was worth doing.

  • @mjowsey

    @mjowsey

    3 жыл бұрын

    @@jgt_ Two completely different ideas. The shape of the Earth is not in question. Einstein looked at gravity and considered that the force we feel is indistinguishable from standing on a platform that's accelerating upwards. This idea is building block of General Relativity. And Mad Mike would have got 10x higher on a scheduled domestic flight.

  • @sarahcb3142

    @sarahcb3142

    3 жыл бұрын

    @@jgt_ Do you happen to know the name of that video? Because that sounds mind boggling to me. If I'm interpreting what you've said correctly, gravity from large bodies doesn't exist but things are held in place simply by the momentum of things hurtling through space? That sounds completely counterintuitive to everything I know about astrophysics.

  • @dontshot12

    @dontshot12

    3 жыл бұрын

    ​@@mjowsey I have to agree with @J Thomas here, we should try to understand where the flat earther's confusion stems from. If he's willing to justify his ideas with (flawed) physics, a slight correction may be all that it takes to make him see reason. He won't admit it outright, very few people have the courage to do so, but at least we may get the gears in his head turning. in a weeks time he may no longer be a flat-earther. Calling him an idiot may be factually correct and can make us feel good about ourselves, but has a zero chance of changing his mind.

  • @vidhoard
    @vidhoard3 жыл бұрын

    Also, can I just say thank you for being one of the smartest, most reasonable liberals out there? I am a strong conservative and, as someone who wants to hear the other side of the argument, I've been struggling to find liberal arguments that aren't just "orange man bad", "the vaccine isn't going to hurt you", and "you are a horrible person because you are a conservative". I just appreciate that at least a few liberals out there have level heads and can present logical, well thought-out, unemotional arguments. I don't agree with many things you believe but I really appreciate you anyway. Keep it up. And know that there are people from the other side listening. I sure as heck am. You're definitely in the top 10 most credible liberals I've been able to find.

  • @hharvey6492

    @hharvey6492

    3 жыл бұрын

    have u heard of Beau of the fifth column? i haven't watched much of there stuff, and theyre not entirely a liberal, but they seem pretty interesting for something on the other side

  • @vidhoard

    @vidhoard

    3 жыл бұрын

    @@hharvey6492 nope but I will definitely check that channel out now! Thanks for the recommendation!

  • @legrandliseurtri7495

    @legrandliseurtri7495

    2 жыл бұрын

    The vaccine really isn't going to hurt you. It's not really an argument by itself, but I don't understand what's bad about saying that.

  • @KH-mx7bg
    @KH-mx7bg3 жыл бұрын

    The American attitude to authority is already part of the reason we are in the vaccine position we are already in. Videos like that make the problem worse. I think Kenneth Miller sums it up well in his book "Only a Theory" about the education nightmare we've had in the United States when it comes to teaching evolution. In the United States we see ourselves as being founded on rejecting authority, and many people put value on it here. In some instances, that's good. Just because someone is in a position of authority doesn't make them right. However, in areas like public health and education, it causes problems. If they want people to get vaccinated, they can't treat them like morons. That will make them feel justified in their opposition. You have to include them like they are part of the discussion. Fostering an "us vs. them" attitude, and then making the mistake of thinking all of "them" are idiots will just cause everyone trouble in the end.

  • @BirdTurdMemes

    @BirdTurdMemes

    2 жыл бұрын

    The first European settlers of America were members of fringe religious groups hated and persecuted by their home government and authority. It is entirely understandable (and well warranted) that Americans are skeptical of authority.

  • @LeavingGoose046

    @LeavingGoose046

    2 жыл бұрын

    @@BirdTurdMemes Not to mention how sketchy our government has been afterwards. The long list of stripping of civil liberties, the long list of crimes done by federal police agencies (that are always called conspiracy theories until proven true), being lied to by Dr Fauci about his involvement in regards to his involvement with gain of function research and his continued employment, the lack of side effects mentioned (ofc every medical treatment has side effects listed in advertisement but this one); I can go on. We have excellent reason to distrust anything coming from our government's mouth.

  • @cavv0667
    @cavv06673 жыл бұрын

    100% agree with you! Being hostile and condescending is antithesis to convincing the opposition that your information is valid/correct. It gets laughs from the vulgar/base crowd that just want to feel superior by agreeing with them, but it is a disservice to the cause!

  • @anarkyster
    @anarkyster3 жыл бұрын

    I had to wince a bit when one of the 'Doctors' said "Let us do our jobs"! I never knew "Bland Comical PSAs" was there in the medical curriculum!

  • @Cabin_Fever13
    @Cabin_Fever133 жыл бұрын

    Brilliant video, thanks for all you do on and off camera. Been watching since early 2020 and you’ve helped me and many others get through this crazy new world

  • @teatowel11
    @teatowel113 жыл бұрын

    I am undecided about taking a vaccine and this skit, although I resist it, makes me feel less inclined to get the vaccine. It speaks nothing to the concerns that undecided people might have. There are a lot of variables to consider, the advice being given is in the interest of the whole population and not necessarily the best interest of an individual.

  • @IrocZIV
    @IrocZIV3 жыл бұрын

    I often run into an issue, where I want to share an informative video, but it's so rude to the "other side" that anyone who I'd want to send it to, would be insulted, completely defeating the point.

  • @ShipCreek
    @ShipCreek3 жыл бұрын

    No one can be convinced of anything. But an atmosphere where its emotionally safe/calm for them to change their mind can be created.

  • @Killer_Turnip
    @Killer_Turnip3 жыл бұрын

    Tone-deaf entertainment at it again. If you make someone feel stupid they'll be much more likely to do the opposite of what you want, just to spite you...if I learned anything in my time as a teenager that was it. Thanks for sharing your opinion on this!

  • @olanmills64
    @olanmills643 жыл бұрын

    The point you made with text at the very end is a really good one. I could imagine this as a skit on Saturday Night Live with actors and the tone changes completely.

  • @MrNicoJac
    @MrNicoJac3 жыл бұрын

    How is this guy talking more sense at 3 am with kids waking up all the time than I am on my best day?? He must be smart. Probably should have become a doctor instead of a KZreadr...

  • @RoshiiMusic
    @RoshiiMusic3 жыл бұрын

    Same people who defend that segment as comedy will try to cancel other people for being "offensive." I swear if people didn't have double standards, they wouldn't have any standards at all.

  • @sadface7457

    @sadface7457

    3 жыл бұрын

    The problem is that trying to be part comedy, public service announcement, and tirade at the same time. You can have funny public service announces, funny tirades, and even a polemic PSA. Trying to do all three is balancing act they failed to pull off.

  • @gordanjenson5148

    @gordanjenson5148

    3 жыл бұрын

    And the people who claim everyone gets "Offended too easily" nowadays, and that we have a "Outrage Culture" will be super offended by this and (predictably) outraged in all their Facebook/KZread Groups. Swings and roundabouts...

  • @platofellas
    @platofellas3 жыл бұрын

    I appreciate subtitles, glad, that more and more people adding subtitles to their videos. Thank you!

  • @marymohr2799
    @marymohr27992 жыл бұрын

    I knew a lady who wasn't sure if getting vaccinated was the right thing to do, because she had heard so many people on both sides saying (sometimes screaming) so many things she wasn't sure what to believe. I think being clear, concise, understanding and factual while addressing fears they have is the best thing to do.

  • @towaii
    @towaii3 жыл бұрын

    8:30 My guy, Next for Autism is not helping people with autism, they're directly harming us

  • @Fionelfia

    @Fionelfia

    3 жыл бұрын

    Exactly. And yet, few people seem to talk about it outside of Twitter. Just imagine what they could have accomplished if they had worked with actual autistic people instead.

  • @Jacklawro
    @Jacklawro3 жыл бұрын

    Think you're right. On a broader point - so much of modern-day comedy (especially on late shows) is basically weaponised opinions, and I can't help but feel the joke only deepens divides, rather than actually helps the problem they're often complaining about. Even though you didn't dunk on some silly theory in this video, I STILL gave it a like. Viva la revolution

  • @Cheepchipsable

    @Cheepchipsable

    2 жыл бұрын

    In the US particularly.

  • @qqlka12345
    @qqlka123453 жыл бұрын

    Thanks for your being yourself. The way you approach the questions we do not know definite answers to is actually inspiring. Keep up the good work!

  • @khazermashkes2316
    @khazermashkes23163 жыл бұрын

    Thank you for having full captions!

  • @m.davies9215
    @m.davies92153 жыл бұрын

    Hearing you say the word "Bellends" has made my week, thank you.

  • @gasdive
    @gasdive3 жыл бұрын

    I love a science video that includes the words "I don't know". It's then I know I'm watching gold.

  • @connorleclair4011
    @connorleclair40113 жыл бұрын

    this actually makes me so happy, i definitely see myself adhering to patterns of doubt and it's frustrating trying to explain what's got me so resentful of what seems like common sense, thanks for putting it elegantly

  • @Cameron-hz9wc
    @Cameron-hz9wc3 жыл бұрын

    Thank you for your willingness to offer counterpoints on things like these. It's always appreciated.

  • @talialalalala
    @talialalalala3 жыл бұрын

    WAT I’m early to my favorite sarcastic British doctor youtuber? Let me just tell the algorithm to boost you rn

  • @crvdsqr
    @crvdsqr3 жыл бұрын

    I did not expect this video to be so philosophical. Greatly appreciate how this opinion piece is not just an emotional rant. Love how you express the principle of charity in your own thought process.

  • @shriramjay818
    @shriramjay8183 жыл бұрын

    Every video brings a fresh perspective.. love your video essays..

  • @cadelisowe4887
    @cadelisowe48873 жыл бұрын

    Holy crap you hit it right on the money. I've only seen a couple of videos from you but the attitude you have towards those you disagree with or are just undecided is spot on for convincing "the other side" to a more factual worldview (one that isnt based on the naturalistic fallacy). There are few people out there who both have a strong online presence and have restraint for "dunking on" people when it is unnecessary.

  • @MicahDeegan
    @MicahDeegan3 жыл бұрын

    I always find it incredibly painful when intelligent people think they can change your mind by shouting at you and mocking you. I have a larger than average number of interactions with people who are terrified of this vaccine through where I live and my work, and most of them are cautious people who are listening to people they trust (friends, family, etc). Yelling at someone and calling them stupid doesn't put you on that list of trusted people they listen to, kindness does.

  • @MicahDeegan

    @MicahDeegan

    3 жыл бұрын

    I still think that data is important, but nobody interprets data in a vacuum. We have to think carefully about context before we speak, it our words are more often than not wasted.

  • @erynlasgalen1949

    @erynlasgalen1949

    3 жыл бұрын

    Trust is the issue. I lost trust in the 'scientists' over a year ago when we were initially told not to wear masks and even shamed for doing so because it took crucial PPE away from medical workers. Having been one of those myself, I knew that even a cloth mask would provide a slight amount of protection and an N95 would be even better at keeping me from overloading the system. We were being told a half truth in that regard. I don't expect the authorities to be any more honest when it comes to furthering their agenda.

  • @damianpos8832

    @damianpos8832

    3 жыл бұрын

    @@erynlasgalen1949 hm..well you welcome to list any proof that mask-wearing in general public does , provide statistically significant benefit in reducing spread...Because there is none on the empirical nor theoretical basis...BTW helt

  • @OzCroc

    @OzCroc

    2 жыл бұрын

    It won't change people's minds. Neither will being nice. Stupid people don't change their mind. We have to round them up and forcefully vaccinate them.

  • @markkealy4417

    @markkealy4417

    2 жыл бұрын

    @@damianpos8832 there demonstrably is

  • @PresidentialWinner
    @PresidentialWinner3 жыл бұрын

    Hahahaha that disclaimer at 0:07 Is something else. I'm already liking this video and it hasn't even passed 10 seconds!

  • @natkobeck7453
    @natkobeck74533 жыл бұрын

    I completely agree with you my man. We can never put ourselfs above. Doctors need to be teachers, acknowledge and embrace all types of people, regardless of what they think. We need to preach, but never mystify or patronize and never make fun. It is not easy, but it is also great mental exercise. Here I always draw the line where my favourite MD Andrija Štampar drew it 100 years ago. All of that still stands! Great video! Thank you for it!

  • @anupneupane6620
    @anupneupane66203 жыл бұрын

    Man you have no idea how much you have changed the way I view things both in medicine and in life.

  • @ankavoskuilen1725
    @ankavoskuilen17253 жыл бұрын

    Flat earthers can harm themselves: When they trip and fall over the edge. But seriously: the doctors and nurses in the video didn't seem like real doctors and nurses to me. Good vaccine propaganda according to me ( but I am not an expert): 1: 'Vaccine song' by Foil, Arms and Hog. 2: 'Get the new jab' by the Marsh family

  • @damianpos8832

    @damianpos8832

    3 жыл бұрын

    wtf...you really want to use propaganda to promote anything health-related?...That means by definition pushing ideology, not science...

  • @petesmith13

    @petesmith13

    3 жыл бұрын

    No propaganda is good and in many places it's illegal for a government to use state sponsored media to propagandise it's citizens... If it's illegal for the government why should it be ok or even encouraged for private entities to do it. Just because these people you've listed have good intentions does not make it good.

  • @markkealy4417

    @markkealy4417

    2 жыл бұрын

    @@petesmith13 its a source thats biased towards truth, if your only definition of propaganda is whether somebody used the word "propaganda" to describe it, then something is very wrong

  • @paulriggall8370
    @paulriggall83703 жыл бұрын

    It's impossible to quantify, yet absolutely undeniable that a good bedside manner (how the health professional acts as a human) is as much a part of health care and healing as medication and treatments.

  • @adid.8526

    @adid.8526

    3 жыл бұрын

    I could actually argue it's one of the most important aspects of medical care, along with a great clinical intuition. Internal med doctors used to tell us : "The diagnosis is found by the bedside, and the treatment in the books" Treatments are changing far too quickly, but the human aspect will never change

  • @tevitamotulalo3909
    @tevitamotulalo39093 жыл бұрын

    Great episode. Fair play. Keep going and hope you do this long time 🤘

  • @proverbialwhatever
    @proverbialwhatever3 жыл бұрын

    One of the videos that drew me to you was I think a pre-COVID one about GOOP, where I think you made a point about how there may have been an social and economic factor into why GOOP and the like have been successful and attractive to women in particular, which is that modern medicine has to an extent failed them. That really resonated with me as a partner of someone with complex needs that are finally being addressed by the right type of specialists that will help us manage the best outcome of an otherwise bad situation. Despite coming from a place of authority and information, being a jerk (even for shits and giggles) has negative side effects and pushback even when trying to make a legitimate point.

  • @SpoonFinder
    @SpoonFinder9 ай бұрын

    A doctor telling me to shut the f k up while reading a script written by television show staff members. Disturbing.

  • @noname-wo9yy

    @noname-wo9yy

    9 ай бұрын

    The fact they got the number of bones wrong while saying they are super intelligent and to not question then as you simply can't comprehend the issue is amazing.

  • @stu-po
    @stu-po3 жыл бұрын

    I and my wife just got out second dose this last week. We could only get them scheduled at different vaccination sites, on different days, and both were over 30 miles from our house. This is the way it is in WA state where the first Covid cases occurred in the US. We are lucky and persistent to seek out a shot. I can understand why some less privileged or less persistent aren't locating a shot. The can't find it, they can't book it, they can't get there. I don't care what the WH says, or east coast news coverage spouts, The shots are not just at the neighborhood pharmacy around here. I can only guess that it's easier for people to say they're not going to get the shot because of some anti-vaccer social network reason, where they real reason is - "it is just too much trouble. " When they get pushed that they are idiots, they will just tune out.

  • @rhonplays
    @rhonplays3 жыл бұрын

    Although you may feel like you have no patience for such ridiculous people, I just want to thank you for having the patience to raise these concerns. Obligatory NAD (but I am a healthcare worker in the NHS), but I get so pissed off at misinformation about medicine being spread, so I can’t imagine how you feel when your career that revolves around patient trust and consent gets hijacked by stupid PSAs on tv shows with no credentials. Especially when the vast majority of the public are bloody stupid. Thank you for taking time out of your busy life to run this channel. I love seeing your videos and I hope you’re keeping well in these difficult times!

  • @andremestre7443
    @andremestre74433 жыл бұрын

    Great video. I think it's worth mentioning too that doctors are not researchers (which is a point that is often made in this channel). Right now the Brazilian senate is investigating Bolsonaro's anti-science handling of the pandemic. Sadly, there are *plenty* of doctors volunteering to defend the government promoting ineffective medicine and other dangerous measures. "Listen to me I'm a doctor - look at my degrees" cuts both ways and it's a *terrible* way to advance an argument.

  • @dnakase
    @dnakase3 жыл бұрын

    Recently I've been diving down the rabbit hole of ALS videos and find that I'm even skeptical of people with lots of letters in front and behind of their names touting their lines of inquiry that could help me. Thanks Rohin, you've helped dial my cynicism up to 11. Now everything sounds like snake oil to me, especially novel compounds or stem cell therapies. But then I'm not a doctor. ;-)

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca3 жыл бұрын

    To note about a more general theme deeply tied to this: There is a very toxic and self-feeding trend in progressive or liberal spheres of influence, where public hostility towards alternative positions is rewarded by more polarised audience. It is a very similar system that got modern right wing media like fox news a lot of critique, and ultimately shifted it's tone rather quickly to the more hard position. Outside of that, the polarisation and self feeding loop of hostility, ridiculing and open denial of offering any sympathy or attempt to understand opposite or differing positions is not a new phenomenon. However it's a rather self defeating one. It locks up the position from anyone outside it, it discourages self-critique and growth of the position or ideal itself, and it obviously heightens any ripples in ideology. One could argue it's a reaction against already immovable situation, and is just natural progression of communities or identities. But it's a bit iffy to conclude so fully, as it's a self-fulfilling argument. In the case of vaccines, it's very easy to see why this approach causes real and clear negative effects, to generate what amounts to amusement, validation and sense of superiority or strength about the ideal or position. It clearly sacrifices getting anyone doubtful of vaccines from being convinced, to get those happily getting the vaccine very exited about having it. If you find yourself seeing similar content about your political position for example: ask yourself, if it's generally helpful to make that sacrifice? Do you struggle towards your ideals, or do you enjoy them as entertainment? If you are unhappy with your answer, you might want to leave places like Twitter.

  • @thebeingdestroyerofworlds8690

    @thebeingdestroyerofworlds8690

    2 жыл бұрын

    This is the most insightful or, may I say 'based' take I've ever seen mainstream liberal media is very myopic

  • @OzCroc

    @OzCroc

    2 жыл бұрын

    Yeah know. We can't change peoples mind. Being "nice" won't do anything. So we should laugh at the idiots as we hold them down and forcefully vaccinate them. That's the only way.

  • @vincent67239

    @vincent67239

    2 жыл бұрын

    There is a lack of sympathy because it has completely run out. Sympathy and thoughtful explanations were given for a long time already, but it has fallen on deaf ears. The only possible reaction now is, “Fuck this.”

  • @fivesidedpixels4991

    @fivesidedpixels4991

    2 жыл бұрын

    @@OzCroc I have the sneaking suspicion you're commenting in the same vitriolic tone across all of your comments. I'll say this: you lack the self-awareness to recognize that you feed into the very problem described in the video. It's in my best interest for everyone who can reasonably be vaccinated to do so. But people with your attitude are what drive people to skepticism or even ignorance. You are literally the strawman that antivaxxers believe vaccine supporters are. At best, your words were ignored, and at worst, you actively turn people AWAY from getting vaccinated. Your attitude and comments do nothing to actually help the situation

  • @OzCroc

    @OzCroc

    2 жыл бұрын

    @@fivesidedpixels4991 Dude do you really think you're going to change anti vaxxers minds? They won't change. Ever. They never do.

  • @pal9878
    @pal98789 ай бұрын

    Like your style 👍- And appreciate the considerate approach.

  • @nemodot
    @nemodot3 жыл бұрын

    Rohin, you have the best nerdy humor ever man, the human organ tier list had me ROLFing so hard.

  • @ioannisaliazis
    @ioannisaliazis3 жыл бұрын

    Totally with you on all points mate and good on ya for making this video! Enjoy your rest 😊🙏🏼💙

  • @funkemunky
    @funkemunky3 жыл бұрын

    I like your point at the end: It isn’t just your crowd seeing what you’re posting.

  • @levitatingmonkeys9544
    @levitatingmonkeys95443 жыл бұрын

    bless you rohin. great video, much needed topic.

  • @mitchelldean5397
    @mitchelldean53973 жыл бұрын

    I love your rambling videos!

  • @ZenoDovahkiin
    @ZenoDovahkiin2 жыл бұрын

    Rule of thumb: When somebody tells you not to think for yourself and just do as you're told, they do not have your interests at heart, they want you to act in their interest, which could align with your own, but don't have to. Does these doctors acting this way mean the vaccine is harmful and ineffective? No. Of course not. Obviously not. But it immediately sets of alarm bells for a reasonable person not to trust these doctors' words. And whether you are actually hiding something or not, you always look like you are when you start saying "don't ask questions and just do as you're told". Questioning "experts" isn't anti-science, it's anti-technocracy and nothing more. If you want people to make better, more informed decisions, you don't promote blindly trusting "experts". What you should actually promote is scientific literacy and an increased baseline understanding of important issues so more people actually understand the issues they are supposed to make decisions on, what the qualifications of an expert actually mean ("they are smarter than you" is not the right answer to that) and what it is the expert is even saying. The expert's explanation for why you should do something should also never be "because I told you to and I know better", that's, again, not being "scientific", but just being a technocrat. The only good idea that was presented in this PSA (though still communicated horribly) was to not act based on unreliable information you found online. That message is in and of itself in theory good advice, but it is advising people to be more critical of information and its sources, which works better when you aren't simultaniously promoting being *_less_* critical of information and its sources. The media also really needs to drop the "just a scientist" routine. There are liberal doctors, there are conservative doctors, there are communist doctors, etc. These people will all have medical expertise, but they will also each have their own biases as to how they think we should, as a society, handle a situation. Therefore, their job is not to rule us, but to advise to the best of their abilities and it is then the job of everybody else to make the most responsible choice based on the information *and* recommendation they have been given.

  • @user-xo2ml4rf9o
    @user-xo2ml4rf9o3 жыл бұрын

    There’s just something so beautiful about plain text remarks during the segment that kills me.

  • @benowzinsky5394
    @benowzinsky53943 жыл бұрын

    As always, informative and entertaining and so correct. Keep up the good work sir. ( on and off the screen)

  • @gptd7178
    @gptd71782 жыл бұрын

    "The surest way to work up a crusade in favour of some good cause is to promise people they will have a chance of maltreating someone. To be able to destroy with good conscience, to be able to behave badly and call your bad behaviour 'righteous indignation' - this is the height of psychological luxury, the most delicious of moral treats.” - Aldous Huxley

  • @theodorebear6714
    @theodorebear67143 жыл бұрын

    *Mate, your scientific rigor in this video is so powerful it deserves to be archived for future generations.*

  • @dr.doppeldecker3832
    @dr.doppeldecker38323 жыл бұрын

    The docter saying stfu made me cringe very hard. Thats the wrong approach to convince people anyway, but especially inappropriate for a doctor....

  • @BfhChaosXX
    @BfhChaosXX3 жыл бұрын

    I see logical fallacies like appealing to authority way too often, even in what should be scientific discussions. Thank you for pointing out the dangers of arguing in this way!

  • @SuperSideKian
    @SuperSideKian3 жыл бұрын

    Thank you! It hurts my heart when I see things like this that effectively gatekeep good knowlege. Im so glad for what you do to change that