Evaluation of Russia by Finnish Intelligence Colonel (subtitles) | December 3, 2018
Martti J. Kari (former intelligence Colonel in the Finnish Defence Forces): Russian strategic culture - Why Russia does things the way it does?
/ maraj60
Subtitles can be opened and changed from the video settings.
If you prefer dubbing over subtitles, full English audio version available here:
• Evaluation of Russia b...
0:00 Personal introduction
0:57 Governmental, political and military questions - How is Russia different from all the other countries and why?
3:04 Russia's six layers in history: Slavic, Byzantine, Asian, chaos, European and Superpower
4:25 Cultural features from the Mongol era: corruption, cruelty and lying
6:43 The era of Europe and Russia as a superpower: Peter the Great, a land between the West and the East
8:17 Geographical nature of Russia, 11 time zones and flat area on the west
9:03 Belief in Russianness at three points: Orthodoxy, autocracy and the people, narodnost
9:23 Autocracy: a central authoritarian regime
10:30 Autocracy: Faith in a fair good tsar and princes
11:04 Autocracy: Boyars between the people and infallible leaders: No right of ownership, but a right of possession according to social status, rules, corruption and nomenclature
13:38 Autocracy: Boyars practically in a modern Russia
14:52 Orthodoxy: The Importance of Religion in Russia
16:20 The people: narodnost, nationality. The Tsar knows better what is best for the people
17:22 Ability to wait and endure suffering and two different realities, sacrificing oneself to the leader
19:04 Homo sovieticus - the new Soviet man
20:40 Faith in Russian summarized before and now - Has anything changed?
21:01 "A little war in the border areas is needed to sustain a patriotic spirit" from the 19th century
21:18 Social system - receiving information in Russia from a state television channel
22:57 The Kremlin's narratives: a besieged fort, a constant war, and an enemy at the gates
24:57 The Kremlin's neurotic view of the world affairs is based on a traditional and instinctive sense of insecurity
26:26 Faith in power and use of force: Deaf to the logic of reason, but very sensitive to the logic of power
27:13 Territorial enlargement: fear-based imperialism
28:10 Asymmetry - Information Geopolitics & Information Influence: Are characters like Johan Bäckman just distracting from real influence?
30:00 Russia's Messianic Mission and Pan-Slavism - The Leaders' Knowledge of Saving Europe
31:18 The Russians seeing the world through history
33:18 How do Russians see Finns? Bronze Horseman - A.S. Pushkin - The Russian landscape through the first poem taught to children
35:11 Russia's technological backwardness throughout history, from ships to atomic bombs to computers
37:36 Russian Truth: The Significance of Language and Concepts, Especially for Lie and Truth
41:05 Examples of the frontiers of lie and truth in a Russian narrative
44:52 Russia's destabilizers in modern times
45:29 What are the Russians afraid of? Fear of internal unrest and striving for a strong leader
48:48 The Russian Landscape Through History, Changes and Similarities: Tsarist Russia, Soviet Union, Chaos in the 90s, 2000s
51:46 Homo re-sovieticus in the last few years: worship of the past and other themes of Russian thinking today
55:13 What does Russia's future look like? Five different scenarios based on history
55:49 Belief in a fair good tsar and princes: Russia's next leader?
58:33 Putin's support and comments on national conditions
59:36 The impact of online youth on Russia's future
Russia's recent actions, such as the occupation of Crimea, the wars in eastern Ukraine and Syria, the excessive use of force against protesters, possible special operations abroad and, for example, the control of the Internet, partly fought against western thinking. However, the Kremlin leadership believes these actions are justified. Justification can be explained through the theory of strategic culture.
Strategic culture refers to the prevailing views in a particular state about the nature of the war and crisis, the threat to the country and the causes of the threat, and the operational options to respond to that threat. Russia's strategic culture is particularly influenced by history, but also by geography, technology and, for example, the political culture and attitudes of the state.
Transcript as a blog post by Ryanad2 here:
the-culture-shocks.blogspot.c...
Questions & Answers -section after the lecture here:
• Tiedustelueversti vast...
Source:
m3.jyu.fi/jyumv/ohjelmat/it/p...
Presented on December 3, 2018
* RIP Martti J. Kari 1960-2023 *
Пікірлер: 3 300
If you prefer dubbing over subtitles, full English audio version available here: kzread.info/dash/bejne/Z3pol8tppsLbZtY.html
@miaumiauimperiumi2951
2 жыл бұрын
Miljoona rikki
@vertexpreacher4854
2 жыл бұрын
thank you for this very insightful view into the Russian mind. the speaker is amazing now in context. Do you have more from him?
@fin_topsu
2 жыл бұрын
Yes. 1. Subtitled videos about this same topic: a) kzread.info/dash/bejne/jKV23KyGda3Xips.html b) kzread.info/dash/bejne/ZGWqusemkty-iZs.html 2. Mr. Kari's Twitter: twitter.com/maraj60
@MegaMrDanne
2 жыл бұрын
Thanks! Now I can listen while gaming. Ei sa peittä ;)
@Mariini
2 жыл бұрын
@@vertexpreacher4854 Check channels other videos.
For those who don't know, Martti J. Kari passed away today on 30.8.2023 after a long struggle with cancer. Even though the man is gone, his legacy and teachings will continue to live. RIP
@tyttiMK
5 ай бұрын
And that is why he is wearing a hat inside. He mentioned in some interview that he was always cold because of the heavy treatments.
Rest in Piece Martti. J. Kari ja kiitos isänmaan eteen tehdystä työstä
@arivanhalakka8997
8 ай бұрын
Mä näin Maran Pasilassa. Kysäsin et kui Ukraina pärjää. Vastasi; hyvin. Ihmisuhrei päivitettiin/katartoitui
@arivanhalakka8997
8 ай бұрын
Tääki saatanan Putinin värkki kirjoittaa mitä tahaan
Rest in peace Mara! Thank you for all that you did for Finland during your career. You will be missed by so many!
I sit through hundreds of lectures each year., and this is hands down one of the best if not the best lecture I've seen in years.Thank you so much. This should be shared worldwide.
@SB-xf6rb
2 жыл бұрын
What about this? kzread.info/dash/bejne/on-Xz7CApsSqhdY.html
@SB-xf6rb
2 жыл бұрын
Or this? kzread.info/dash/bejne/h2GEj9aRYJfFfKQ.html
@SB-xf6rb
2 жыл бұрын
@sakor88 No, just another part of the story
@marcinb4647
2 жыл бұрын
@@SB-xf6rb These are not exactly lectures but still very interesting and insightful videos so thx for the links matey
@skandre7776
2 жыл бұрын
@@marcinb4647 these are not insightful but thickly sewn russian propaganda's
RIP in peace Martti, he died today. He had lots of knowledge about warfare and Russia and his expertise was greatly appreciated. Really sad, I wish well for his family and relatives!
I am Sakha, ethnic minority from Siberia. Really like the lecture. For me, it is like thinking out of the box, since I mostly live inside the propaganda bubble. The bubble is supported by the state and ordinary russians. While getting older, I find out many russian lies around myself, especially in media and in history.
@karkkimarkkinat2109
2 жыл бұрын
Russians have a lot of propaganda, sure. But we have tons of it ourselves. Our media is far from free and honest. Not everything in media is propaganda either, their assessment of the west as an enemy is correct. The west is trying to take down Russia.
@alexp7579
2 жыл бұрын
@@karkkimarkkinat2109 The West is not trying to "take down Russia". Putin regime yes, but not Russia. The west was optimistic it could befriend Russia in the 90's and early 2000's but it didn't work out. Remember that Russian propaganda is not only targeted to Russians but exists in the West as well.
@mattivirtanen4043
2 жыл бұрын
@@karkkimarkkinat2109 why?
@atommi1
2 жыл бұрын
@@karkkimarkkinat2109 that is biggest bullshit ever, whole europe is falling apart becouse of the ukrainian conflict. Why would we want that.
@karkkimarkkinat2109
2 жыл бұрын
@@alexp7579 ok let's start playing semantics, that's what I ultimately meant. But if you think they'll let Russia thrive without Putin, I've got some bad news for ya
Finland always straight forward and best ! big respect from Estonia🇪🇪🇫🇮
@kamalatharat
2 жыл бұрын
We still have had a fair share of mislead politicians regarding eastern neighbour. Your former president Ilves gave a good rebuke on 2 high ranking leftists we've had in power. I think estonians have a more realistic view :D
@Raimond799
2 жыл бұрын
As a Finn, if Russia or somebody else would attack against Estonia, i would join to defense our brothers and sisters in blood.
@nonameplsno8828
2 жыл бұрын
@@Raimond799 Well then,here is something relevant for you;since Belarus is allowing free movement of Russian troops they managed to encircle Ukraine-it's the entire reason they took Crimea. But that is not all-if you look at google maps you can see that merely getting their troops to Kalingrad means that the three baltic states get surrounded. And there was news that Russian and Belarusian forces did joint exercises in Grodno region,four days ago. Their leaders want at least a piece of former soviet union back,it really doesen't matter how many of their people get nuked in retaliation.
@rhalfik
2 жыл бұрын
Tere
@jaanuspeet2458
2 жыл бұрын
@@nonameplsno8828 great find, news say they have "cooperation base" there. Awfully close to the Suwalk corridor.
Hands down the single most informative lecture I have ever listened to. As a European guy I feel for the first time that I have some real insight into Russia, it's history and it's people. Scary and utterly fascinating at the same time. It's also somewhat depressing. Prior to the criminal invasion of Ukraine, I always found it tragic that Europe and Russia cannot build bridges of understanding and move closer together. I was hopeful that it was possible in the future. After watching this brilliant presentation, I sadly understand why that may never happen.
@mth9267
2 жыл бұрын
IT may happen
@waltergregoireshling
2 жыл бұрын
I'm also European and i never had an encyclopaedic knowledge of "Russia", but i clearly saw signs of hostility, brutality, threats and hatred, from Russia. And yet i was sure that doing the same thing would have been a mistake, so i kept seeing things from their sides, accepting that "our" side is in the wrong or could be, being magnanimous in the name of peace and harmony for us and the Russians. But now, they crossed a red line and they need to be stopped, what they did is monstrous, and they are threatening us. Yet we must remember that there is still innocents in Russia, people against all of this, the main culprit is the bloody government, that is the evil that must be destroyed, not Russia. Peace and bridges should always be on our minds.
@senecathefuka441
2 жыл бұрын
It just takes time
@helavatar
2 жыл бұрын
Yep. If it happens then maybe after next extinction period. The red army is doing the exact same things in Ukraine as it did during the occupation of Baltics and in Karelia. They lie so much that for them it becomes the truth.
@OOpSjm
2 жыл бұрын
@@waltergregoireshling red line?
greetings from Poland. This is very informative and it perfectly confirms what we know in Poland. I hope as many westerners as possible listen to this.
@AJ-vy4yu
Жыл бұрын
“You must understand, the leading Bolsheviks who took over Russia were not Russians. They hated Russians. They hated Christians. Driven by ethnic hatred they tortured and slaughtered millions of Russians without a shred of human remorse. It cannot be overstated. Bolshevism committed the greatest human slaughter of all time. The fact that most of the world is ignorant and uncaring about this enormous crime is proof that the global media is in the hands of the perpetrators.” ~ Aleksandr Solzhenitsyn
@asiamies9153
Жыл бұрын
@@cu6upckuu48Many russians have said the analysis is spot on. Maybe you should elaborate and not just say it's wrong
@raf.b
9 ай бұрын
@@asiamies9153 he just said this presentation is very accurate
I am not an expert in the field of politics, but in my opinion, the author has accurately analyzed everything and understood the essence of the processes. I live in Russia and I can agree with him.
@dmitrykhrykin
2 жыл бұрын
@@ultraveridical It's more the Mothreland's infallibility, than the Tsar's. And it's 100% there, in most of the Russians. Russia just can't do anything bad or wrong. If somebody accuses Russia of it, there must be some explanation for why the accuser is wrong. Russian would seek that explanation naturally and would find it. However implausible it might be. So the Motherland is infallible. But who's in charge of the Motherland? The Tsar is. So he gets the infallibility also, by extension. Especially in international affairs.
@niklasleandr
2 жыл бұрын
@@ultraveridical speaker literally says, these oligarchs went into prison for taking part into politics or stealing from wrong guy.
@niklasleandr
2 жыл бұрын
@@ultraveridical this guy has said multiple times diffrent platforms oligarchs went into prison for stealing too much, taking part into politics or stealing wrong person. hes made some statements recently and ive seen hours of this footage, and i dont need subtitles either. you can have your opinion couldnt care less. history tends to follow along wether you want it or not. so i wouldnt agree that history doesnt matter todays behavior. seems like you are allready offended for nothing so you lost objective thinking long time ago.
@neovxr
2 жыл бұрын
yes and no. naturally, there must be a balance established between clarity and freedom. it will always fluctuate a bit, same with quantum physics. the black ad white thinking that he promotes will inevitably grant too little of space and must converge into something totalitarian. how can a non-binary person like masha demand binary reasoning from everyone else? let me warn you that AI that is being forced into black-and-white logics, will most likely enslave and then destroy humanity.
@63Limar
2 жыл бұрын
@@kirillfedorov8715 ??? Вполне по теме. Бумеры жрут говно с телевизора, молодые имеют шанс употреблять контент с интернета, в том числе на английском языке. Демократия "дермократия" действительно стала ругательством, патологическая боязнь НАТО. "Ну потерпим, потерпим", любовь к крепкому авторитарному сапогу в жопе. Вполне хороший анализ, с упоминанием западников и славянофилов, фашисткий запашок от многих "традиций" и ожиданий от человека. Минин и Пожарский и тп.
During the first half of the video I just wanted to cry. All this is very true. As someone who was exposed to the internet and the diversity of information since childhood, I feel trapped in my own country because of the propaganda. People around the world probably see the anti-war protests in Russia (alas, not very big, many are afraid of imprisonment and the special police unit for internal oppression) but if you wonder what is discussed in the kitchens - families are fighting within themselves, parents vs children. The younger generation (less than 30-35 y.o.) is very unhappy, anti-war and ashamed of what’s happening. Those older, those who watch TV - they do have this mentality and this belief in the infallible president. They can’t explain why they support this personally, the propaganda changes the reason for the war every couple of days, and it’s easier to repeat it. I’m kind of afraid that this mentality will infect us (the younger generation) too eventually. It’s like a plague. For now the propaganda only becomes stronger, the independent press has already been blocked and banned
@kalleukko2277
2 жыл бұрын
As Finn, remember that path is open for you to move here or anywhere in Europe. It might be the best way to protest against your government, by taking your talents and skills to another, more open and prosperous country.
@Thezftw
2 жыл бұрын
They're suffering from cognitive dissonance. It's also crazy how Putin says one thing and then does the exact opposite himself. He claims the "special operation" is to de-nazify Ukraine, but then he sends actual neo-nazis (Wagner group) to assassinate Ukraine's government and it's jewish president. That's some tactical truth right there...
@LanaelMean
2 жыл бұрын
@@Thezftw Kremlin propaganda is based on "it's not all so clear-cut" point of view. This creates a dangerous illusion that you are simply unable to see the whole picture and should leave all the important decisions to the government, the president, etc. This helps them justify any atrocities. After 22 years of this kind of brainwashing you can say "2+2=4" and the responce from the people would be "you just don't see the whole picture" (without any implication that they see the whole picture themselves) Putin knows this so he doesn't really care about the incongruities.
@christianpeter7165
2 жыл бұрын
Thank you for sharing you comment. This is ridiculous. Here in Germany we are scared how Russia is just terminating Freedom of speech. For Russians. They are very good people actually. But the politics is leading them unfortunately..
@LanaelMean
2 жыл бұрын
@sakor88 Something similar to the first one happened yesterday, actually. A girl was threatened and beaten by a policeman at the police station for taking part in the protests (agains war). It was Sunday so many people were at the rally and about 4000 were arrested, all in 1 day. Some protesters are better prepared for this kind of situation so they find ways to record audio as evidence and then share on the internet. Made some noice, but no one can really do anything about it. No option of holding the policeman accountable. But believe me, even living in a totalitarian dictatorship it still feels very surreal when you see the police beating someone at the rally with sticks, legs and tasers. 4 people on 1.
As a former Russian Voice Interceptor US Army Military Intel, and Russian Studies Major in the early 1990's.... I have to say this is the most spot on evaluation that I have ever seen. And on a personal note I feel ashamed of myself that I did not come to the same conclusions. The deeper "core" escaped me. I did not see the continuity to the 21st Century and I have smacked my forehead.
@cuhurun
2 жыл бұрын
Chris... Having served with the BAoR during the 1980's, I wish I'd have had access to the following book back then, it's an amazing insight into the racial and folk psyche of the Russians. I refer to - 'The Slave Soul of Russia: Moral Masochism and the Cult of Suffering', by Daniel Rancour-Laferriere. Perhaps you've already read it, if not, I'm sure a man of your past profession would find it profoundly worthwhile. Best regards.
@ferdinanddaratenas3447
2 жыл бұрын
Can you break the Russians, despite being used to enduring tremendous harship? If the Ukrainians keep resisting and the West has patience to enforce the sanctions and wait for them to make a deep impact, do you think the bear will finally break like the USSR or something? Thanks
@Mehumekko
2 жыл бұрын
@@milanradovanovic3693 Hi Milan, seems like this guy did hit in the hard spot. I admit that there is some weak sides here & there but there is simply too much truth. Please study little bit more about those guys who he is presenting down there from 20th century like Dugin. Too close to call. How do you slavic do have the feel in a way that you are the ones who have been always mistreated? Please get over it.
@christianebrace7828
2 жыл бұрын
I think the most people also here in EU could see that or wanted to realize.
@christianebrace7828
2 жыл бұрын
could not see this, i meant:)
Tämä pitäisi jonkun ehdottomasti tekstittää ja jakaa joka valtion hallinnoille!! Saatesanoina suomalainen tiedustelueversti, yliopisto, venäläisyyden historia
@kallekallenen4346
2 жыл бұрын
Just kuuntelin eilen Frederick Kagan kerto ihan sanansta sanaan samat asiat. Lännessä on opeteltu tää tietty tyyli katsoa kaikkea tästä suunnasta.
@deslow7411
2 жыл бұрын
Siinähän on tekstitys Englanniksi.
@juhojalonen3046
2 жыл бұрын
@@kallekallenen4346 Kas kuuluisa Kallesen suvun edustaja Pietarista.
@K055U
2 жыл бұрын
@@kallekallenen4346 Vanha kunnon Kalle Kallenen. Venäläistä kekseliäisyyttä
@juhaylimaki2543
2 жыл бұрын
tämä pitäisi saada jokaiselle suomen nykyhallinnossa katsottavaksi mahdollisimman pian!
As someone who lived under Russian imposed communism I can attest his analysis is so spot on it gives me the jitters. Absolutely incredible insights from someone born in the free world.
@TheBinaryHappiness
2 жыл бұрын
communism is jewish. if you don't know that you don't understand us, Russians, at all.
@karlisauce3356
2 жыл бұрын
Of course russians never did anything
@karlisauce3356
2 жыл бұрын
@@TheBinaryHappiness So boasting of people you've beat up and threats of a bad future for me?
@test-tl8dt
2 жыл бұрын
@@TheBinaryHappiness your country has never been in a defensive position at war. never in a honorable battle. just bombing small populations for geopolitical power because you fail to negotiate literally anyone to be on your side, because youre a rubbish backwards country no one in the modern world wants to deal with.
@master_ace
2 жыл бұрын
I'd like to apologise for the antisemitic mysoginist in these replies. His crazed ravings are not representative of all Russians' views
I am Russian. Listened the first 20 min. So far the lecturer's evaluation is correct. Pleasing that someone understands your mentality. Respect to the speaker. Will try to watch until the end.
@ingrudmessenger1193
2 жыл бұрын
I'm curious as i think he leaves out a couple important points, but partly that might be my memory. I only remember about Jelzin as a teenager, but from my perspective as west german... he was really bad for russia. Not just constantly drunk but also gave away resources and stuff to western companies for almost free. I was not surprised at least that people voted for somebody entirely different. Another important thing is that it was actually Putin who asked NATO if russia could join and was essentially told to fuck off. So i'm also not that surprised that he sees NATO as a threat. Do you share that view? Or do you have an entirely different one?
@juhanivalimaki5418
2 жыл бұрын
@@ingrudmessenger1193 NATO did not tell Russia to F-O. NATO told Russia, that to join NATO a country has to be democratic. (Well, sometimes maybe less democratic countries have been granted access for strategic reasons). The requirement of democratic state with working juridical system was too much for the people in power in Russia. That's why we have the oligarchic Russia outside of NATO still today.
@thedukeofno
2 жыл бұрын
@@juhanivalimaki5418 ...and I think it was actually Yeltsin who was first proposing that Russia join NATO.
@vladimirlensu423
2 жыл бұрын
Dmitry, please share your thoughts. I suggest you translate my comment 3 days ago from Finish, so I hear you reaction on it too.
@vladimirlensu423
2 жыл бұрын
@@juhanivalimaki5418 Nato is founded to "keep US in, Russia out and Germany down". Nato is constantly looking for new members which can either bring Nato closer to Russia or give money in Nato budget. Finland can bring both, so fears about opportunity closing has no ground. US will always welcome Finland to Nato.
Jokaisen pitäisi katsoa tämä luento. Tämä myös osoittaa, miten vähän lännessä on tiedetty Venäjästä ja venäläisyydestä. On hurjaa, että maantieteellisesti noin lähellä olevalla alueella voi olla niin eri maailma, josta Suomessakin harva kauheasti tietää. Kiitos Martti J. Kari upeasta työstäsi. Kuolemasi on suuri menetys. Liian aikaisin lähdit.
This was a really excellent presentation. I was only going to watch a few minutes, but found it so interesting that I stayed through the end. Leaders and decision makers in the West really need to see this. Even with my limited study of history, I have felt like there are many times where western leaders just completely misjudge or misunderstand how and why Russia thinks and acts the way it does. From those misjudgements and misunderstandings come reactions and policies that make things worse, not better.
@vvp_rus
2 жыл бұрын
This bastard was uttering absolute nonsense and Russophobic myths denigrating and demonizing Russia.
@Delheru
2 жыл бұрын
@@vvp_rus I think you are flattering yourself it's Russo phobia. The time of being afraid of Russia is long gone. It's more a mixture of contempt and pity for a people whose unfortunate history has made them the most instinctive slaves on the planet. It's really rather sad. They will go full Nazi rather than challenge their leaders... but then again, they have always liked killing each other for the glory of symbols
@vvp_rus
2 жыл бұрын
@@Delheru What you wrote is Russophobia. Proclaiming the deprivation of all Russians on the national basis of human dignity is an innate Nazism in you. You have just described the concept of looking at the people you fear and who have historically defeated and dominated your people. It's you who live in the past and the ghosts of the past pull your criminal views into the present. This is a destructive and dangerous view. People or a nation with Russophobic views should be afraid if they have at least a drop of intelligence, and if they are not afraid, then they are madmen and fools. To suggest to oneself the idea of the stupidity and mediocrity of Russians is a very big misconception and very far from the truth.
@vvp_rus
2 жыл бұрын
@@Delheru As for the leader. In the current circumstances, leadership has strengthened. Those who did not support before, now support a lot. A pitiful handful of dissenters took to the streets, but their percentage is negligible and they cannot influence the situation inside the country. If, under military, political and economic pressure, a consolidated nation is a crowd of slaves for you, well, you have no brains.
@Delheru
2 жыл бұрын
@@vvp_rus you point out Russophobia is somehow irrational, and then proceed to make veiled threats. And here I thought cold logic was something of a strong point among Russians. And no, Russians aren't particularly bad. Russia is just like most other countries with
This delivers more value than 100 hours of political Talkshows on TV.
@catcatcatcatcatcatcatcatcatca
2 жыл бұрын
That’s because Finland has very straight forward interests when it comes to Russia, compared to what kind of discussion benefits the channels hosting those talk shows.
@vvp_rus
2 жыл бұрын
This bastard was uttering absolute nonsense and Russophobic myths denigrating and demonizing Russia.
@bluewhitespartan5258
2 жыл бұрын
@@vvp_rus No. We know better. Facts always stay facts.
@vvp_rus
2 жыл бұрын
@@bluewhitespartan5258 You need to know the facts, and not to drive convenient information under the picture of the world imposed on you by someone unknown.
@bluewhitespartan5258
2 жыл бұрын
@@vvp_rus Facts are seen in Ukraine you desilusional hypocrite. Russians Attacken a peaceful country. You are done.
Amazing presentation and great work on the English subtitles. I hope every person gets to watch this and learn. Russia is very confusing to the outsider and this lecture makes it clear. We should all be thankful to the Colonel for giving the lecture and for people recording it and putting it online.
@AJ-vy4yu
Жыл бұрын
“You must understand, the leading Bolsheviks who took over Russia were not Russians. They hated Russians. They hated Christians. Driven by ethnic hatred they tortured and slaughtered millions of Russians without a shred of human remorse. It cannot be overstated. Bolshevism committed the greatest human slaughter of all time. The fact that most of the world is ignorant and uncaring about this enormous crime is proof that the global media is in the hands of the perpetrators.” ~ Aleksandr Solzhenitsyn
@AJ-vy4yu
Жыл бұрын
The international finance must be taken down
@PC_Simo
Жыл бұрын
@@AJ-vy4yu *_YES ✊🏻!_*
As a russian I really appreciate this video. It has a lot of in-depth info with so many good points. I have to point out though that there is only ONE meaning for truth. "Pravda, Chestonst', Istina, Deistvitelnost" all mean an actual truth and reality. 'Pravda' is a word common in all slavic languages. You either disguise your lie as truth or not, but the actual meaning is only one. 'Istina' is rarely used in the spoken language but it means more like divine truth or truth that can't be ignored. For words meaning lie it's a different story. There are different types of lies. "Lozh" is a lie that is used to gain something from others. "Vranjo" is a lie that a person uses to distort the truth to protect themselves from shame. The language is best understood when you speak it.
@rykehuss3435
2 жыл бұрын
Ironically pravda as a word came to mean lie (embellishment etc) in finnish political slang, because of the Pravda newspaper publishment that constantly lies to russian people.
@Deri_Seh
2 жыл бұрын
@@rykehuss3435 Yes it can mean that or anything to you. You are not russian.
@AlfaGiuliaQV
2 жыл бұрын
@@Deri_Seh That´s because it´s meant for internal interpretation in our country. A joke if you will, since we are neigbours but fundamentally live in different worlds.
@whippoorwill910
2 жыл бұрын
The fact that we all know what a “white lie” means in English also shows that many cultures have multiple meanings for “lies” - to help us deal with inconvenient or difficult situations or truths.
@InqvisitorMagnvs
2 жыл бұрын
@@whippoorwill910 That's not comparable to different Russian words for lie reflecting cultural differences. A “white lie” in English is told out of courtesy, respect, diplomacy of the person being 'lied' to, not for personal profit or self-gain, e.g. a wife asks her husband whether her new dress looks nice and he says yes even if thinks it's ugly. Or how world leaders play along with the “white lie” that today's Russian Federation is still a 'superpower' like Soviet Union was to placate Vladimir Putin in diplomacy... Of course in fact we found out later the Soviet Union was never really the superpower it pretended to be-just very good at lying and disinformation warfare. On paper USSR was a paradise that had no crime, no plane crashes, always ahead of its 5-Year Plans, nobody in any level of the whole corrupt Soviet system dared report to Moscow anything but good news... England did not expand from part of a remote island into the dominant global Anglosphere with such a culture of corruption where there could be room for interpretation of different degrees of truth or lie. Leaders in politics or business did _not_ want to be told “white lies” about serious subjects and in exchange be allowed to steal your cut of corruption money for keeping the system going. Just the opposite: you would be punished if you covered up problems and stole any amount of money, instead expected to find and solve problems on their own initiative and report accurately. Anglo-Saxon societies enforced rule of law and contracts; citizens relied on such honesty in daily lives. If you said you would perform some job or task by a certain time in exchange for some agreed amount of payment from another party, with as little as a handshake both parties were expected to do just what they said, regardless of who the people are or whatever the circumstances, whether you had connections to some influential person or not.
One of the best hours I've spent in a long time. Easy to understand and full of facts about a current subject.
@kirillfedorov8715
2 жыл бұрын
but that bullshit
@rykehuss3435
2 жыл бұрын
@@kirillfedorov8715 ok kirill fedorov
@MOROZOV1974
2 жыл бұрын
This is professional propaganda my friend. Made for people who do not like to think or research. No facts in this video. None. Just pure propaganda. Paid by Finnish/EU goverment. I am just wondering, why he did not mention about bears on the streets of Russian cities, balalaika playing everywhere and about children drinking vodka at school for dinner?
@rykehuss3435
2 жыл бұрын
@@MOROZOV1974 Several russian people have commented here that the information is accurate. Who are you again, except a pro-Putin troll?
@MOROZOV1974
2 жыл бұрын
@@rykehuss3435 , if someone has different point of view does not mean he is fake. Look, what western prapaganda did to you.
Kepeät mullat Mara ja kiitos tekemästäsi työstä.
This is absolute gold for anyone trying to understand Russian thinking. I even understood most of it without English subtitles thanks to my childhood MTV3 and YLE tv watching. I really loved Masha Gessen's books, she excellently describes the same problems. Greetings from Estonia!
@TheWisestOne1
2 жыл бұрын
Tervitused Soomest! Mul on ka palju sõbru kes õppisid soome keelt (v noh, pigem aru saama) Soome telekat vaadates. - Olge tugevad ja vankumatud! Soome-ugri rahvad jäävad alles.
@MrKatajisto
2 жыл бұрын
This is for the very beginners who are only starting the lifelong path of learning politics.
@reijoheikkila4578
2 жыл бұрын
EU,lla hätä. Natolla hätä. Tulee eu, kansalaisille muhkea taakka harteille, kallis muhkea hintalappu. Maksuja piisaa, pakolaismaksut tulee eu,lle mielettömän kalliiksi. Paljoko maksaa puolassa olevien miljoonan pakolaisen täys ylläpitomaksut. EU, maksaa joka sentin, siis tavallinen EU, kansa. >>> Myös täällä natoa ja eu,ta puoltava kansa, he maksavat kaiken. Hyvin menee vai mitä,.?
@jonnenne
2 жыл бұрын
@@reijoheikkila4578 no ei mene, kiitos Putin. No ei ainakaan kuolla nälkään niinku ryssät tulee ens talvena kuolemaan
@pcgaming7680
2 жыл бұрын
@@reijoheikkila4578 kremlin trolli ??
Tack så mycket för föreläsningen, mycket ljup insikt.
This is excellent and should be shared as much as possible
@AJ-vy4yu
Жыл бұрын
“You must understand, the leading Bolsheviks who took over Russia were not Russians. They hated Russians. They hated Christians. Driven by ethnic hatred they tortured and slaughtered millions of Russians without a shred of human remorse. It cannot be overstated. Bolshevism committed the greatest human slaughter of all time. The fact that most of the world is ignorant and uncaring about this enormous crime is proof that the global media is in the hands of the perpetrators.” ~ Aleksandr Solzhenitsyn
@AJ-vy4yu
Жыл бұрын
///Putin/// and others like ///him/// must be stopped
It's the most comprehensive and precise description of russian mentality. Many of those facts I know as its neighbour, many were named very precisely. I like this part about rules of stealing. You can not steal too much in relation to the status you have, you can not steal from certain persons who are above you. It's all so in point. Ppl in the world dont't know or underestimate those Mongol influences in that nation.
Excellent work on the subtitles. This is perfectly clear and informative.
@ChristianConrad
2 жыл бұрын
Well, I'm fairly sure the Czar in the opera (at 18:34 I think) needed to be saved from a swamp, not someone's gut... 🙂But yeah, apart from that and perhaps a few other tiny bloopers, on the whole a very good translation.
@fin_topsu
2 жыл бұрын
Thank you. The lecture can be now viewed also with English audio: kzread.info/dash/bejne/Z3pol8tppsLbZtY.html
i am a Russian, and Im agree with 95% of this lecture, very accurate and truly - you described a mentality of all Russians over 30 y.o. nowadays. The new generate thinks differently, at least I see this
@seidr9147
2 жыл бұрын
Awesome to hear that young generation is thinking differently. World is changing and we should change along with it.
@emptyvoid8196
2 жыл бұрын
@sakor88 Unfortunately, there are many people in Russia who approve this war, they watch too much TV. It is very sad when you realise that some of your relatives are among them, very difficult to even talk to your family, because "we are fighting nazis" and your point of view is "American propaganda" to them. But at the same time there are many people, who are really brave participating in the protests, risking their lives (in Russia it is literally so) to show that not everyone agrees with this madness.
@jackwolfski
2 жыл бұрын
@@emptyvoid8196 Im not pro Putin and I am not pro NATO but what I understand about my own country and I worked for NATO when Putin was the head of KGB in late 80´s. NATO and the U.S. would never allow Putin to set up shop in Cuba, Mexico, or Canada. We would have gone to war with any country that would think about doing that, so why should Putin not react this way? U.S. started a coup in Ukraine in 2014 trying to undermine Russia and yes there are many Nazi groups in the Ukraine, AZOV being one of at least 4 that have ties around the world to other groups so Putin is not lying and is being surrounded like Martti says they feel. If your pro America like most Finns then its easy to be bias. I am pro Truth and America has lots of blood on its hands in other countries and our Intelligence sabotage many to get what we want. So, we are no better.
@emptyvoid8196
2 жыл бұрын
@sakor88 Yeah, I can't even imagine how can anyone really want to go and kill anyone. I'm sure lots of Russian guys fighting there in Ukraine didn't want to do this too, I heard a lot that they were told about the trainings till the very last moment. I guess this is the reason why many Russians just ran away and left their tanks. Once you sign the contract to serve in the army, you can't disobey till the end of it, otherwise you'll get under tribunal.
@emptyvoid8196
2 жыл бұрын
@@jackwolfski I'm not in any way pro America, and this situation is surely very beneficial for US, as Russia will get very weak economically and politically. I have watched the video recently where Pozner was talking to Americans in 2008, questioning what would US do if Mexico would start acting like Ukraine did, and would ask Russia to bring several divisions to the border with US just for being safe. Surely US would act the same way. And most likely EU and friends wouldn't say anything about it, no sanctions to US or whatever.
Olipahan väkevä luento! 🙏🏻 Nämä asiat itsellä ollut hyvin sirpaleisesti alitajunnassa kyllä tiedossa ja välillä sieltä on tietoisuuteen pulpahdellut samaa logiikkaa, mutta nyt yhdistyi todella paljon pisteitä tunnin aikana. Kiitos! Jos tähän saisi tekstityksen venäjäksi, niin olisi huikea juttu
@Benderkekekekekeke
2 жыл бұрын
Venäjäksi tekstitys löytyy asetuksista. Tiedä sitten miten hyvä. Englanniksi näyttäisi ainakin olevan ihan laadukas käännös.
@jonitatti8888
2 жыл бұрын
@@irinalehtinen1155 Seems like you need to read some other than Russian official history books 🤓
@en1080
2 жыл бұрын
@@irinalehtinen1155 No, kuka ei sotinut? Ymmärsitkö kuulemaasi? Se ei ole niin, että muut maat ovat Venäjää vastaan. Vaan Venäjällä luullaan niin, että muut ovat sitä vastaan.
@put_your_grasses_on.
2 жыл бұрын
@@irinalehtinen1155 I guess these russian propaganda bots are one example of the mentioned "tökerö vaikuttaminen."
@aljonapinegina5097
2 жыл бұрын
@@irinalehtinen1155 вероятно вы читали только школьные учебники, раз так говорите.
As a Russian, I would say that the lecture is well contemplated and I did enjoy it. I watched it twice using Russian and English subtitles and have to appreciate the precision of translation. This is funny how, mr. Martti J. Kari refers to such marginal figures like Alexander Dugin or Navalny as they both represent diametrically opposite philosophies, but they aren't popular among Russians these days. Some insights regarding to the multi-layered authoritarian tradition in the Russian political culture are very accurate. Russia isn't a libertarian state. After the 90s, Russian society started to radicalize against the collective West and now we are undeclared adversaries.
@niklasleandr
2 жыл бұрын
"After the 90s, Russian society started to radicalize" this sounds dangerous, it really does for future :/
@user-qc3il8ru7l
2 жыл бұрын
@@niklasleandr society here is already radicalized to the level of fascism. We had a transitional period, described in this lecture, when "homo soveticus" did not feel safe, it was just the 90s. but my generation was just then born and raised on Western values about the rule of law, and now that the "restoration" of authoritarianism has taken place, many of my peers are depressed. Because we cannot influence all this in any way, there are too few of us. Now, due to the culture of abolishing "Russian" all over the world, our propaganda uses this, and that part of the population that watches TV willingly believes that there are only enemies around us. It can be said that my generation is lost. We will either leave here, or we will be forced to play by rules alien to us, or we will simply be put in jail if we do not give up our views. Although now it’s almost impossible to even leave, because it’s not Russia that closes the borders, but the entire civilized world (which is surprising for me personally, we were waiting for the Iron Curtain 2.0, but we were waiting for an initiative from our government). Perhaps we will be able to change something when the Putin regime weakens, but every year we believe less and less, and especially now.
@eugenekronn
2 жыл бұрын
@@user-qc3il8ru7l dude, are you a Navalny supporter? 😆
@lastburning
2 жыл бұрын
@@user-qc3il8ru7l Finland has taken in a lot of Russians since Russia invaded Ukraine.
@user-qc3il8ru7l
2 жыл бұрын
@@lastburning i know, and big thanks to finns for that. I've been to Finland many times, it's a great country with great people. I hope that when all this is over, those who moved will return and will be able to improve our country using your experience. This is of course naive, but in order for something to change, such idealism is needed. Otherwise, there will remain a dull swamp. I live and was born in St. Petersburg, and every time I went to Finland (I prefer the train) I was surprised by the contrast. as soon as you cross the border, the landscape outside the window changes, you can see the rational use of the territory, well-groomed small houses. This makes it even more offensive, because we have a huge potential, and with the proper approach and desire, we can live much better. But everything collapses on human stupidity and greed.
This was a great lecture. The insight to the russian people and way of conducting themselves was well explained and fascinating.
@helliblomerus8633
2 жыл бұрын
vvvzæ
@helliblomerus8633
2 жыл бұрын
cç
@helliblomerus8633
2 жыл бұрын
cc ç ç ç ççc
@helliblomerus8633
2 жыл бұрын
ç
@CZOV
2 жыл бұрын
Only one problem, its completely wrong and fabricated out of thin air.
Crazy that thus was done 2018, we need an updated speech!
@jarkovartiainen8043
2 жыл бұрын
Why ? Nothing has changed.
@gtboard
2 жыл бұрын
@@jarkovartiainen8043 God point but his thoughts on whereto end the Ukraine situation and how to deal with it. Cut off Russia I guess.
@Mariini
2 жыл бұрын
kzread.info/dash/bejne/ZGWqusemkty-iZs.html
@hoplahey
2 жыл бұрын
Short version: All I said was true, nothing has changed. We are now in the phase where Putin either will be thrown or a new leader will be appointed that will pardon him.
@gtboard
2 жыл бұрын
@@hoplahey The Tsar never does amything wrong. 10 000 dead. 10 million dead, who cares? 🙄
Everyone should see this lecture. Please share this to your friends or colleagues. Westerners simply don't understand how Russians think, but this will open your eyes. Subtitles included in many languages.
@jennilizie
2 жыл бұрын
How to access subtitles?
@yeet7929
2 жыл бұрын
@@jennilizie go to video settings and then subtitles and then choose what subtitles u want. English should be great, dont know about the other ones.
@davidhq
2 жыл бұрын
@@yeet7929 you also have the option to auto-translate (have to use desktop)... almost all languages are available there ... Settings (little cogwheel next to CC icon under the video) → Subtitles (CC) → Auto-translate → Choose any language
@hukubis
2 жыл бұрын
Implying what you see here is the truth and not the same sort of disinformation that germans were spreding about jews at the begining of it.
@palacio802
2 жыл бұрын
I do not agree. I'm from Spain and this video while interesting, only tells things that I already knew. It matches more or less with the opinion of most people in western countries have about russians and Putin's regime. The value of this video is that it explains and confirms all the shit.
If KZread was dominated by this kind of quality, I'd gladly pay for it. On the other side, it's important that this kind of information is available for everyone. Btw, imagine if this was a series covering all kinds of countries.
@vvp_rus
2 жыл бұрын
This bastard was uttering absolute nonsense and Russophobic myths denigrating and demonizing Russia.
@neovxr
2 жыл бұрын
@@vvp_rus Africans have lived in the West long enough so today with the digital Gutenberg, they are firm in answering the Western "theories" on their cultures. Many facts on Russia are correct but expressed in condescending ways.
@Bruh-jr2ep
2 жыл бұрын
@@vvp_rus Please explain further. What did he say that was wrong?
@vvp_rus
2 жыл бұрын
@@Bruh-jr2ep Almost the entire lecture is primitive propaganda of hatred on national grounds. Lecturer obviously came under the influence of "internal Russophobia" existing in the minorities of ethnic minorities of Russia, and among anti-imperialists who consider the struggle with Russian identity as the basis of the fight against Russian imperialism. In any case, the views and assessments promoted by the lecturer are infinitely far from reality and create a fundamentally wrong idea of Russia, Russian culture and history in the listener. If the first third of the lecture can be perceived as a primitive pseudoscientific interpretation of well-known facts, then the lecturer proceeds to purely evaluative statements, outright lies and strongly distorted facts. Unfortunately, Europe is full of horror stories about Russia reproduced from century to century and dehumanizing attitudes about Russians.
@professionalprocrastinator8103
2 жыл бұрын
@@vvp_rus What do you think about Putin and his war, Vladimir?
This was something what every single person should watch
Fascinating. Seems more impressive since it was filmed a few years ago and all the prognostications were on point.
Todella mielenkiintoinen esitys, kiitos kun postasit tämän fin_topsu.
This is an amazing presentation. I must say that many things pointed out here for Russia, stand also for Serbia!
@jesss1561
2 жыл бұрын
Serbia is like a mini Russia in Balkans.
@unknownentity8256
2 жыл бұрын
All of this applies to all Ex-Soviet countries, pretty much.
@ArstotzkaEmpire
2 жыл бұрын
@@unknownentity8256 not all soviet countries.
@tanerbaubec
2 жыл бұрын
@@unknownentity8256 Romanian here, as a nation I'd say that we have a rather low self esteem and no romantic view of the past whatsoever. We've always been at crossroad of empires and usually the national pride comes from surviving these regional powers and still have a country today. More, I think there's a general consensus among generations under 45 that communism was a cancer that kept us many decades behind the west.
@robykxxx
2 жыл бұрын
@@tanerbaubec Well, Romania was never really "soviet", maybe only for a short time, considering the entire timeframe.
When I watched this a week ago, I thought this could be very valuable with translations. Great that someone handled it so we can share the knowledge.
@ratatosk8935
2 жыл бұрын
Me from Germany: Kiitos paljon tekstityksistä!
@fin_topsu
2 жыл бұрын
You can now also watch the lecture with English audio: kzread.info/dash/bejne/Z3pol8tppsLbZtY.html
I guess the whole thing can be summarized like this: In Russia, the purpose of the entire Russian people and society is to serve the interests of whoever happens to be at the wheel at that moment, and this system is enforced by any means necessary. Said interests mainly revolve around maintaining power and control, the welfare of the people rarely becoming a concern for those involved. "The truth" is whatever benefits the powers that be, and this is systematically propagated both inside the country and abroad by voluntary or involuntary agents. Basically it looks like we should probably view any message or business proposition by the Russian government or corporations as a likely hybrid operation, with the intention of securing the current Russian government and undermining anyone who they see as an enemy, which is pretty much the rest of the world. Most importantly, we should only be looking at what Russia ACTUALLY DOES, instead of listening what they SAY.
@user-ce6iy2nw5o
2 жыл бұрын
No, it's not about the leader, russia with it's people and instituions are just like a c*ncer except it's designed to spread itself to all directions more efficiently than cncer
Erittäin mielenkiintoista settiä!! Avas silmät aivan uudelle tasolle!
@reijoheikkila4578
2 жыл бұрын
No nytkö jo aivosi puhistui. Aika nopeasti se kävi.
@put_your_grasses_on.
2 жыл бұрын
@@hannukoistinen5329 Moni meistä varmasti kyllä tajuaa ketä vastaan todennäköisemmin soditaan kun soditaan, mutta harva tietää miksi vitussa.
@petskuaija3944
2 жыл бұрын
@@put_your_grasses_on. tälläisessä sodassa ole vitunkaan järkeä mikä nyt on ukrainassa venäjän hyökättyä sinne. venäjä ei tee ukrainan maa alueella hevon vittuakaan ja se tappaa siviilejä. tämä sota on putinin ja sille on mennyt ilmeisesti ukrainen presidentti ihon alle ja putin ei lopeta ennen, kuin se on saanut zelenskyn hengiltä ja tuhottua sekä tapettua ukrainan kansaa. ainoa mikä estää länttä liistimättä putia on se, että länsi ei demokratiaattisina maina halua eskaloida tilannetta. ukrainan sodassa on yksi ainut henkilö maan päällä, joka tietää miksi tuota sotaa käydään ja se on yksin Putin! kaikki muu on on spekulaatiota ja syytä voi vain arvailla..
@muovi2463
2 жыл бұрын
@@petskuaija3944 "ainoa mikä estää länttä liistimättä putia on se, että länsi ei demokratiaattisina maina halua eskaloida tilannetta" Ydinaseet
R.I.P. Mara. We will miss you.😥
Bravo! This is indeed a very clear explanation of Russian folk psychology.
Excellent ! Good to listen to someone who really knows his subject matter. P.S. I'd like to visit Finland one day.
@Mestari1Gaming
2 жыл бұрын
Please do visit us! All who love freedom & democracy are welcome here.
@alanpartridge2140
2 жыл бұрын
@@Mestari1Gaming But maybe we'll be eaten by wolves or bears or attacked by moose
@Make154
2 жыл бұрын
@@alanpartridge2140 m.kzread.info/dash/bejne/Ymyat7WdkZO1fqQ.html
Easily the best presentation I've seen in years and super relevant. It also makes complete sense and gives such accurate insight into Russia that we can see literally at work right now. Amazing
One of the best lectures I've found in KZread so far
Thanks for the video, it was quite interesting to see this point of view. I'm Russian, though haven't been living there for several years. Most of it is true, but not all. My great-grandfather was sent to Gulag for several years, lost everything he had, and then exiled to a small village in Murmansk region (it is the very North of Russia, on the shore of the Barents sea). And after that he still was proud to be a communist, building the society for future generations. And his son, my grandfather says that now we have a generation of consumers who only think of their own benefit, not about the country and the society. People of the age 30 (at least everyone who I know well) and younger don't see the West as the enemy, they condemn the purges of the Soviet time, and they are against of what's going on in the country these days. I don't want to be this stereotypic Russian from the video, being afraid of the period of turmoil, but Russia failed its liberal attempt in the 90s, people were literally surviving, not living. And when Putin came to power, he was quite good for the first several years, he really did good things for Russian economics, performed reforms that improved the people's lives. Honestly, he could have been remembered as a great president who saved Russia from poverty in which it was left in the 90s. But as he was staying longer and longer something changed in him and now he will be remembered as a bloody tyrant.
@karvakana922
2 жыл бұрын
Yeah, these kinds of lectures etc. always get some information wrong. Because after all, these are just observations of an outsider and it is difficult to make a summary of a nation. Heck, I'd be interested in hearing a similar kind of lecture about us Finns from Russians, hah. It is very depressing that this is happening.
@blechtic
2 жыл бұрын
I'm not sure it's even fair to call that a failure, because ten years, without having any previous experience, isn't a very long time to try to make it work. No doubt many mistakes were made and questionable ideologies followed. If you look at the rest of the Eastern Europe, you can see that it takes awhile, even if there was some kind of a tradition of democracy. I did see a brief mention, though, (possibly on Maximilien Robespierre's last Sunday brunch stream) that while Putin got the credit, it wasn't actually him fixing the economy. The system described here would explain why he got/was given the credit for it.
@skandre7776
2 жыл бұрын
People were poor in 90s because mafia's and oligarchs had stolen everthing there was of any value. Army of post soviet officials and services would never let power and influence move away from them. There was no chance for any fair economical transformation without proper program like there was in Estonia or even Poland because post soviet economies were basically bankrupt on the start . . It was consequence of decades of top-down socialist economy in which there was no checks and balances. Liberalism became convienient scapegoat. What Putin was good early on whas inflicting terror and fear , the economy only bounced up after oil, gas and other resources started flowing outwards but mostly due to oil
@A-E-O-N
2 жыл бұрын
It's a quite widespread misconception that better economics in the 00's was Putin's merit. No, there were two main factors not at all depending on Putin. First, economic reforms of the previous Yeltsin's government (particularly Gaidar's shock therapy) in the 90's that took their real effect a few years later, by around the time Putin had first come to power. And second, extremely high oil prices that coincided with him taking office, too. However, I would agree that had he left politics in 2008 after his two terms, he would have been most likely remembered as a good president. Something went completely wrong after that, though...
@MrDrury27
2 жыл бұрын
@@A-E-O-N Putin's greatest contribution was allying with the organized crime and letting it become the new ruling class in and of itself, solving the issue of corruption by simply embracing the corruption. Unfortunately for him (or rather, the Russian people), this form of government corrodes the country from the inside out over time, and even more unfortunate was the external factors that allowed it to continue for as long as it has. Russia is now, for all intents and purposes, a giant Potemkin village unable to fall back to even its basest instinct - outward expansion. And so Putin will be remembered as the savior turned crazed warmonger who tried and failed to crush an innocent brotherly nation under his heel, when in reality he has been the vampire sucking the blood of his own people from the very beginning. That latter part will be forgotten however, for times of suffering is just another necessary part of life in the Russian conception and barely worth a mention in times of plenty. It's no mistake that a layer of fresh flowers decorates Stalin's tomb. And whoever comes after will again be the one to rebuild the empire from within and be celebrated as a hero, before the same outward expansion is attempted again. The endless poetry of Russian history rhymes on and on.
I feel like I've just walked out of the opticians with brand new spectacles.
Rest in peace Martti! 🙏
Tack för detta - en riktig ögonöppnare!
Excellent video and extremely informative. Thank you!
Wow. This was on point. As for Putin's successors, one fell off a cliff : "Zinichev died on 8 September 2021 in Norilsk, aged 55, during the filming of an interdepartmental exercise to protect the Arctic zone of Russia. According to the ministry, he fell off a cliff while trying to save the life of director and cameraman Aleksandr Melnik, who also died." From the Russian Federation: "Vladimir Putin held a meeting, via videoconference, with Governor of the Tula Region Alexei Dyumin. September 14, 2021." So, there's only 1 successor left according to this, and Putin met with him just a week after the other one "fell off a cliff."
@j.m.7715
2 жыл бұрын
Close to the Czar, close to death --an old Russian saying
@131alexa
2 жыл бұрын
😬
Kiitos tästä! Nyt ymmärtää taktista tai ulkoista totuutta hiukan paremmin!
@Tuppoo94
Жыл бұрын
Ei sitä tarvitse ymmärtää sen kummemmin, koska kyse on puhtaasta paskanjauhannasta, johon vain idiootit uskovat. Katse täytyy pitää tiukasti siinä, mitä venäläiset TEKEVÄT, sen sijaan että kuunneltaisiin mitä he sanovat. Puheiden tarkoitus on vain toimia hämäyksenä, minkä aikana pesäpallomaila valmistellaan kalauttamaan kuulijan kallo halki.
Tosi mielenkiintoista!
Already by historical section you can understand that this is a great work and a really deep research. Outstanding work, veli! Watching everything happening in such a way is mind blowing. It is especially strange going thru this shite considering that even russian governor of Republic of Karelia is not really that in support of everything. At least the initial reaction was very late and not that RUSSIA URA style propaganda. As of now, the greatest concern is the future of this “federation”, where the real owners of Karelian land - Karelians and Finns - don’t even have their languages considered state languages. This will change pretty soon, my inner Karelian says. At least I would like more autonomy to be present to us, as it feels for me too strange, a Karelian Schwabe, that in Karelia we are just like not even remotely autonomous. Thanks for the lecture! Karjala on olevaa vapaa!
Historiasta kiinnostuneena minulla olikin jonkinlainen käsitys siitä mitä Venäjällä on tapahtunut viimeisten 200-300 vuoden aikana pääpiirteittäin. Olen myös huomannut, että Venäkällä demokratia ei toimi, koska kansa haluaa vahvan johtajansa (=tsaarin kaltainen). Tämä esitys kuitenkin veti erinomaisesti yhteen eri kohtia Venänälisten motiiveista ja kansan "luonteesta". Tiesin, että Venäjällä on paljon korruptiota, mutta "tsaari ja prinssit" (=vahva johtaja ja oligarkit) systeemin suunnitelmallisuus ja rooli Venäjälllä oli minulle yllättävä tieto. Yksi asia oli kuitenkin ylitse muiden. Siis se, että totuudelle on olemassa Venäjällä kolme eri sanaa, jotka tarkoittava aika tavalla erilaista "totuutta".
@rkan2
2 жыл бұрын
Demokratia ei kauheen moneen paikkaan ole tullut verettömästi ja voi olla hankala ymmärtää demokratian päälle kun ei ole oikeaa demokratiaa koskaan kokenut.
@TuomasLevoniemi
2 жыл бұрын
@@rkan2 Ei voi... Samasta syystä Lähi- Itään ei ole hups.. tullut enemmän demokratioita. Vaikka se (meidän mielestä) on ylivoimainen systeemi. Tuhansia vuosia vanhoja perinteitä vallankäytöstä on vaikea (ellei mahdoton) muuttaa.
@kusipaa8683
2 жыл бұрын
@@TuomasLevoniemi Kyllä ne täälläkin muutettiin. Se vaatii aikaa. Opiskele Euroopan historiaa.
@kallekallenen4346
2 жыл бұрын
@@kusipaa8683 Kusipäisen paska kommentti. Ne muutettiin täällä suorasta kuningasvallasta, esivallan "voimasta" pehmeäksi pakotteeksi. Meillä siis valtiot pakotetaan "yhteen" muilla tavoin kuin suoraan väkivaltaisesti. Väkivaltaa käytetään vain paikallistasolla demokratiassa. Ei valtioiden järjestelmien välillä. Ei meilläkään komissaareja valita, tai EU:n presidenttiä vaaleilla haeta. He valitsee itse keskuudestaan. Periaatteessa EU:ta voisi laillisesti hallita vain yksi suku, jos he aina esittäisivät jatkajansa omistaan. Mutta jostain syystä katsotaan, että tämä on sitä parempaa paskaa.
@blechtic
2 жыл бұрын
@@TuomasLevoniemi Kyse ei välttämättä ole niinkään pelkästä vallankäytöstä vaan myös yhteiskunnan rakenteista. Eikös Lähi-Idässä ole suku-/klaaniperustainen järjestelmä, johon koko yhteiskunta oikeusjärjestelmä mukaanlukien nojaa? Liberaali demokratia on yksilökeskeisempi. Vanhojen rakenteiden muuttuminen vie aikaa, vaikka vallanpitäjät pyrkisivätkin niitä purkamaan. Jos niitä pyritään säilyttämään tai vahvistamaan, muutos on hidasta. Altistuminen toki muokkaa vähitellen mielipiteitä.
"neurotic sense of insecurity" - good one and explains a lot!
This was an hour well spent. Educative and entertaining. Awesome. I've got a lot of new insights and things to think about. Thank you for Posting this...
@fin_topsu
2 жыл бұрын
Glad you enjoyed it!
Thank you so much for the subtitles. This was the best 1 hours of my life. Subtitles were enough for me, I actually like hearing spoken Finnish.
Ajankohtaista asiaa! Erittäin hyvin selittää tapahtumia, asenteita ja yleistä maailmannäkemystä idässä.
@reijoheikkila4578
2 жыл бұрын
Tulee EU, kansalle iso lasku. Jo miljoona pakolaista puolassa. Paljoko arvelet olevan koko hintalapun kun ukrainan sota on ohi. Että, irvailkaa siihen kahtoen, TE, maksatte joka sentin.
Erittäin hyvä luento, ja valitettavan ajankohtainen.
@colettemorassut4553
2 жыл бұрын
Hei Olen pahoillani, että otin sinuun yhteyttä tällä tavalla, en usko, että se on sattumaa. Olen Katrin Elena Morassut Blankenburgista, tällä hetkellä Namurin linnoituksen aluesairaalassa. Viimeisimmän eilen saamani analyysituloksen mukaan lääkäri selittää minulle lyhyesti, että voin menettää henkeni minä hetkenä hyvänsä. pallo, joka asettui aivohäkkini, minulla ei todellakaan ole enää toivoa. Etsin rehellistä hyväntahtoista henkilöä, joka voi auttaa minua rukoilemaan tilani puolesta, jotta voin vastaanottaa minulle paljastettujen pienten lasten siunauksen. Laitan tarvittaessa taloudellisia resursseja, autan tahdolla. Pyydän sinua vastaamaan minulle suoraan sähköpostillani, minulla on suuria vaikeuksia painaa näppäimistöä. Sähköposti: colettemorassut1951@gmail.com Colette
@democracyalways9801
2 жыл бұрын
Haluan auttaa sinua. Ota yhteyttä!!!!! Paljonko tarvitsi rahaa? How can I help You?????
@colettemorassut4553
2 жыл бұрын
@@democracyalways9801 Poikani, minulla on todella paljon vaikeuksia painaa näppäimistöä, kirjoita minulle postitse jos voit auttaa minua tahdon kanssa
Muchas cosas desconocidas han sido despejadas gracias a esta buena presentación, de fácil entendimiento. Gracias.
@colettemorassut4553
2 жыл бұрын
Hei Olen pahoillani, että otin sinuun yhteyttä tällä tavalla, en usko, että se on sattumaa. Olen Katrin Elena Morassut Blankenburgista, tällä hetkellä Namurin linnoituksen aluesairaalassa. Viimeisimmän eilen saamani analyysituloksen mukaan lääkäri selittää minulle lyhyesti, että voin menettää henkeni minä hetkenä hyvänsä. pallo, joka asettui aivohäkkini, minulla ei todellakaan ole enää toivoa. Etsin rehellistä hyväntahtoista henkilöä, joka voi auttaa minua rukoilemaan tilani puolesta, jotta voin vastaanottaa minulle paljastettujen pienten lasten siunauksen. Laitan tarvittaessa taloudellisia resursseja, autan tahdolla. Pyydän sinua vastaamaan minulle suoraan sähköpostillani, minulla on suuria vaikeuksia painaa näppäimistöä. Sähköposti: colettemorassut1951@gmail.com Colette.
@PC_Simo
Жыл бұрын
@@colettemorassut4553 Hyvä yritys 🙃.
Wow, I had one enlightment after another. Incredible presentation. Thank you so much for the German subtitels!
@fin_topsu
2 жыл бұрын
Thank you for watching! Good to hear the Google Translate subtitles from English are understandable as well.
@drtm9966
2 жыл бұрын
@@fin_topsu Well translated in portuguese also. First I saw in english subtitles. After I found in portuguese.
Ompa hienoa pohdintaa.. jokaisen pitäisi kuunnella tämä! Kiitos.
@tiinapaltia8016
2 жыл бұрын
Todella mielenkiintoista ja ymmärrettävästi kerrottu, kiitos!
@kellygrand1506
2 жыл бұрын
Nuo kaikki on tiedossa Venäjällä
Olipa hyvä luento ja luennoitsija! Kiitos!
This is next-level lecture right here! I learned a lot. Thanks for uploading!
Excellent, Excellent, the whole WORLD Should be listening to this lecture. Thank you Martti Kari ❤❤🎆🌞
kiitos. Erittäin hyvin toteutettu, ja validi tänään eritoten.
Best video so far. Great work! Amazing!
Watching the video now again and reading the comment section now 6 months after the war started and I have only one thing to say: "Se koira älähtää johon kalikka kalahtaa." If the lecture was worthless, the trolls would not care - so congratulations!
@hegara376
Жыл бұрын
Yeah, and it's totally not suspicious that many of the "critics" or hate comments recently written were in finnish (since only finnish speaking people would watch such a lecture, of course). Those trolls aren't what they once were.
Thank you for sharing this.
@fin_topsu
2 жыл бұрын
You're welcome Mr.
one of the best lectures on the topic
Fantasamogical. I am subscribing now because even though I can’t keep up with your language and have to read the subtitles pause rewind it is just fantastic
Thank you for this video! I learned a lot. It is very important to understand how and why others think and act the way they think and act. Very insightful indeed -- I have read plenty of books on (mostly Soviet) Russia to understand the enigma, but there is plenty of insight here that I never came across. Highly recommended.
@jmolofsson
2 жыл бұрын
I was impressed when I once read a quote from Paasikivi, along the lines of "the more he had learned to know the Russians, the less he had understood." Well, maybe not exactly so, but anyways, it impressed me that this (highly) intelligent man, who had studied Russian and been in comparably close contact with Russia, could feel so. I guess the view one gets of Russian culture, when one learns the language in school, necessarily gets romanticized. I have a relative, my sister-in-law, who is a Russian teacher. I wonder what her students would have said if they, on an early stage, were given this to watch.
bardzo ciekawy wykład, miło słyszeć że Finowie potrafią odczytać rosyjskiego ducha podobnie jak Polacy, niestety krajom zachodu łatwo było zakochać się w ruskich bajkach o socjalizmie gdyż nie poczuli go na własnej skórze.dlatego np.narody z nad Bałtyku widzą to prawdziwych kolorach.pozdrowienia z Polski
Man oh man is this lecture on point
Tekstitykset jollakin aikataululla englanniksi olisi kova juttu. Voisi löytää yleisöä ulkomaita myöten.
@juhaylimaki2543
2 жыл бұрын
Tämä olisi erittäin toivottavaa!
@zaqwsx28
2 жыл бұрын
Sama venäjäksi!
@fin_topsu
2 жыл бұрын
Valmis, myös venäjäksi.
@tonaaspsusa
2 жыл бұрын
@@fin_topsu Olisi kenties myös hyvää jos videon kuvaukseen saisi englanniksi ja venäjäksi pari sanaa? Ihan ylhäällä (ensimmäiset 3 riviä) voisi olla tyylin "English description, see below" ja sama venäjäksi.
@fin_topsu
2 жыл бұрын
@@tonaaspsusa Hyvä huomio. Tällä hetkellä video näkyy otsikon ja kuvauksen osalta kokonaan englanniksi, mikäli käyttäjän kieliasetukset KZreadssa on niin. Itse asiassa sama tilanne on suomen ja englannin lisäksi myös venäjäksi, ukrainaksi, saksaksi, ranskaksi, ruotsiksi, espanjaksi, portugaliksi, italiaksi, hollanniksi, puolaksi, turkiksi, hindiksi (Intia) ja thaiksi. (Englannista käännettyinä Google Translate -versioina) Saa nähdä onko vaikutusta sanoman leviämiseen. Mikäli kokonaan englanninkielinen kuvaus vaikuttaa liian heikentävästi näkyvyyteen esim. niiden suomalaisten osalta, joilla KZread on englanniksi niin vaihdetaan takaisin suomeksi, aika näyttää.
Todella mielenkiintoinen luento, tack!
Kiitos, tämä info auttaa ymmärtämään ja puolustait umaan heidän " lookista" ajatustapaansa vastaan, minä on aivan toinen heidän ajatustapanssa. Menttalitentti , uskoisisin , ei ole kuitekaan 100% kansan keskuudessa, mikä tulin esiin. Vain vahva vastarinta voi olla ratkaisu pysäyttää maailmanpalon !
Kyllä oli harvinaisen selkokielinen esitys everstiltä, KIITOS!
@colettemorassut4553
2 жыл бұрын
Hei Olen pahoillani, että otin sinuun yhteyttä tällä tavalla, en usko, että se on sattumaa. Olen Katrin Elena Morassut Blankenburgista, tällä hetkellä Namurin linnoituksen aluesairaalassa. Viimeisimmän eilen saamani analyysituloksen mukaan lääkäri selittää minulle lyhyesti, että voin menettää henkeni minä hetkenä hyvänsä. pallo, joka asettui aivohäkkini, minulla ei todellakaan ole enää toivoa. Etsin rehellistä hyväntahtoista henkilöä, joka voi auttaa minua rukoilemaan tilani puolesta, jotta voin vastaanottaa minulle paljastettujen pienten lasten siunauksen. Laitan tarvittaessa taloudellisia resursseja, autan tahdolla. Pyydän sinua vastaamaan minulle suoraan sähköpostillani, minulla on suuria vaikeuksia painaa näppäimistöä. Sähköposti: colettemorassut1951@gmail.com Colette
@TheAlternative_27
5 күн бұрын
Haistan pistävän curryn tän kommentin kautta😂
I haven't noticed any western politician speaking recently as if they are remotely aware of the points/insights presented here. This really is a must-see and everything makes much more sense to me now.
@flipvanhaaren7218
2 жыл бұрын
Was thinking the same. I fear most of these people talk and talk in meeting after meeting, not taking time for background info like this.
I speak Finnish well enough to know that this deserves much better English subtitles. Everyone in the EU and NATO member states should hear this.
@fin_topsu
2 жыл бұрын
I agree. You can suggest improvements to the English subtitles on this open document, please: docs.google.com/document/d/1REPlzRsenZPWkJWERs8LiYrtyzYVs8Z_dmhVWU9AvBM/edit
As an Estonian born in 1970s I have seen Soviet times first hand. But I have had a little bit of hope that maybe Russia can change course. Now, I don't think don't think it will happen in the next 20-30 years. Hopefully we don't have WW3 as Russia is poking around with a bayonete to find mush
One of the very best lectures I have ever heard!
Absolutely brilliant. This lecture explains so much that I have never understood about the Russian attitude towards life, foreign policy and the rest of the world. Thank you for posting it!
Fantastic.All the world should watch this.
When all you have is a hammer everything looks like a nail. But when you have a hammer and a sickle everything appears to be a swastika.
@PC_Simo
Жыл бұрын
True. Must destroy swastika 😵💫.
Olen laittanut merkille monta videolla nähtyä asiaa jo etukäteen, mutta on puuttunut hyvä selitys miksi näin on. Näitä ovat mm. voimapolitiikka, venäläisten ykköspoliitikkojen räikeä valehtelu, ajatus kylmän sodan asetelmasta (joka on väkisin tuotu esiin viime vuosina uudestaan lännessä). Video on vuodelta 2018, joten osa yksityiskohtaisista tiedoista on muuttunut siinä ajassa, mutta kokonaisuutena sisältö pitää paikkansa. Jospa tämä kouluttaja saataisiin julkisiin haastatteluihin.
Etnisesti venäläisenä voin vahvistaa käytännössä kaiken. Yksi venäläinen sanonta suomennettuna: "Kaikki ovat tasa-arvoisia omassa arvottomuudessaan tsaarin edessä". Venäjää on tavallaan feodalistinen maa: oligarkit on kuin uuden ajan aatelisia, joilla on omat oikeutensa muut ovat lähinnä maaorjia eräänlaista feodaalista resurssia, jota hyödynnetään teollisuudessa ja taloudessa. Niin kuin keisarillisenkin venäjän aikaan jos olet maa orja niin vaikka opiskelisit yliopistossa ja tekisit töitä insinöörinä jäät maaorjaksi. Ei sillä että olisin mitenkään tuota järjestelyä vastaa. Siihen on totuttu. Laitoin sitä nyt vaan historialliseen perspektiiviin.... Sitten venäläisten taito kopioda vetää kyllä vertoja venäläisten omille sanonnoille Kiinan panssaritorjuntaryhmistä: "Jouoksee panssarivaunulle, purkaa, kopioi, rakentaa ja laitaa myyntiin AliExpresiin". Kun Yhdysvalloissa arvioitiin että neuvostoliitolla menee 10-15 vuotta kehittää ydinase ne kopioi sen kolmessa vuodessa.🙃
@tatianaishchenko6684
2 жыл бұрын
Напиши как эта погорка звучит по русски, я пойму .
@AttilaKattila
2 жыл бұрын
Ihan jännä sinänsä mutta maaorjuus Itä-Euroopassa ja Länsi-Euroopassa vaikuttaa vähän kuin kahdelta eri jutulta, liekö syy sille miks toi termi on nimeltään mitä on mahdollisesti se että se liittyy esimerkiksi vaikkapa maaorjuuden muotoon mitä vaikkapa Virossa oli, joka kuitenkin on ikäänkuin naapurimaa. Sanoisin myös että feodaalinen yhteiskunta on ennemminkin valtion rakennusprojekti, ei niinkään talousjärjestelmä tai valtiomuoto tms. Tietysti Suomessa (ja Ruotsissa) tällaista vaihetta ei oikein tapahtunut edes.
Very good lecture. I learned a lot.
so good! this lecture needs to be broadcasted at Prime time on all major channels.
Tärkeää tietoa. Kiitos!
Todella mielenkiintoinen luento. Kiitos
Paras luento ikinä. Kiitos!
@MrKatajisto
2 жыл бұрын
Sun pitäisi opiskella enemmän... elämä jatkuu please!
@JuhaErkkila
2 жыл бұрын
@@MrKatajisto Mistä aiheesta pitäisi opiskella enemmän? Mielipidevaikuttamisesta vai ruplan kurssista?
Thank you for this. Very interesting to watch and learn.
@Scumbo14
2 жыл бұрын
perustele!
Erinomainen video!
Good work very interesting and well done 🇪🇪
Kiitos! Tästä oli erittäin paljon apua!
Thank you fin topsu for translating this very valuable lecture ❤❤☺☺🌞🌞🙏