They look kinda like a honeycomb you could call it the busy bee calendar

@GoldenPantaloons

4 жыл бұрын

Hey, that's pretty good!

@Hjylps

4 жыл бұрын

I like it!

@josea.r.avelino181

4 жыл бұрын

"BEE ON TRACK" Calendar.

@greensteve9307

4 жыл бұрын

@@josea.r.avelino181 Genius! :D

@babyplaze

4 жыл бұрын

Michael Steinmetz genius.

omg i cant stop staring at her necklace

@Julq4

4 жыл бұрын

yeah where can i buy it??

@tinseltail

4 жыл бұрын

poxodi it’s by a British company called Tatty Devine!

@eddynator5847

4 жыл бұрын

@@Julq4 its a 125€ tho

@MrBibibip

4 жыл бұрын

What is it made of?

@Julq4

4 жыл бұрын

@@eddynator5847 aliexpress or ebay it is then lmaooo

Should offer an "Expansion Pack" that is just a single standalone LED button with sticky Velcro and a "29" on it. =)

@asteiner2000

4 жыл бұрын

RndmMthd this!!

@WhereWhatHuh

4 жыл бұрын

say, "That issue will be addressed in the 2.0 version."

@ribbitgoesthedoglastnamehe4681

4 жыл бұрын

Sell it as "Season Pass".

@Efflorescentey

4 жыл бұрын

+

@joesamsally

4 жыл бұрын

Obiously it will be a limited run series, only available every fourth year.

I just want to say, I really like the name 'Everyday Calendar'. While it's true that every calendar shows every single day, most calendars are split by month and you don't actually see every single day. Shifting the focus from months split into weeks into each individual day helps with the step-by-step process of routine, and 'Everyday Calendar' encapsulates that beautifully.

"I feel guilty asking for money" is the most scandinavian thing ever

@catcatcatcatcatcatcatcatcatca

4 жыл бұрын

Scandinavia have a proud history of successful unions - but then again unions would work the same if all workers wanted fair compensation for all the other workers instead of themselves.

@theespatier4456

4 жыл бұрын

Hannah Steinum Kvalvik A few Swedish extreme-right municipalities have literally outlawed begging in recent years.

@stoffni

4 жыл бұрын

@@theespatier4456 lmfao... "EXTREME-RIGHT". Stop your bs.

@KnowItAllNERD

4 жыл бұрын

@@theespatier4456 ...I was more talking about how I, as a scandinavian, hate asking for money. I don't ask for money from my parents because I get student loans and tuition is free, so if I blow through that money it is because I fucked up and failed at being independent (something that I feel is valued in society) Also I am lucky enough to have the privilege to not have to ask for money. #middleclassnorwegian

@98Zai

4 жыл бұрын

@@stoffni You know, it's all relative. Outlawing begging on one side, and having a generous welfare system on the other side is pretty much black and white. It's not extreme compared to US, so you're right in some sense.

Don’t feel guilty that we’re watching! We’re watching at work.

The calendar is cool and all, but where can I get that groovy dinosaur necklace?!

@WhatsBliss

4 жыл бұрын

Joulery is the company that makes it.

@MyAncientSpirit

4 жыл бұрын

typetrouble they’re apparently sold out of everything and I want the entire collection

@hoxton_hummingbird

4 жыл бұрын

@@MyAncientSpirit google showed me a similar one on rakuten for 12$ store/pangaea/item/10000080/

@johnpeters7073

4 жыл бұрын

Literally just Google “Dinosaur necklace” or “T rex skeleton necklace”. There are dozens upon dozens of of companies that make these.

@DeezN00tz99

4 жыл бұрын

Aliexpress for like 3 dollars or something

The everyday calendar is the perfect name. The everyday part isn't about having all of the days, it's about doing whatever you're doing everyday. Don't change it 🙂

So change the name to The Every Day Except February 29th Calendar.

@toysareforboys1

4 жыл бұрын

I can't believe they didn't put the 29th on the calendar! insane.

@SternLX

4 жыл бұрын

Well, You could always buy a Gold Star sticker sheet and put a Gold Star on there that day when there's a leap year. It'd be the Calendars special day as it's the only one with a Gold Star. Of course it would be pealed off at the beginning of the next year. :)

@petersherman2552

4 жыл бұрын

@@toysareforboys1 you get the 29th off, no meditating or exercising that day. Lie on the couch and eat potato chips instead

@murirokcs5518

4 жыл бұрын

Love it

@KarryKarryKarry

4 жыл бұрын

The fact that this calendar has NO way of keeping a record is just baffling. Why would you make this? For the question at hand: You could just put a counter into the electronics so whenever you get to 2020 you can light up the 29th. I doubt you’ll keep it longer than that but to each his own. Or you could use the interwebs (January 1st) and send a time request to any NTP server to get the year. When thinking about that you could also put some calendar client software on there and have it light up dates you’ve marked in your calendar. TBH it would be ALOT simpler to just run the whole thing off a raspberry pi with WiFi and have it scoop all your caldav and outlook data along with a voice assistant that notes stuff in your calendar. My gods.. so many wasted possibilities.

Sign a couple of them or include a thank you macaroni art

@abouttogiveyasomefacts5574

4 жыл бұрын

Wouter Schip yas that would be cool

@vizionthing

4 жыл бұрын

You barstewards, as if checking 366 days on all 200 isnt enough you now want to add to her work load!

@wissamelkadamani9750

4 жыл бұрын

@@vizionthing 100%

@Biosquid239

4 жыл бұрын

Macaroni art would take forever but signing might be nice to do on the first batch atleast.

@damongki

4 жыл бұрын

@@vizionthing do you mean 365? cause there's no February 29th

I'm a manufacturing engineer and LOVING how she's explaining the complexity

@tanmaypanadi1414

4 жыл бұрын

What products have you been part of ?

@dogcarman

2 жыл бұрын

@@tanmaypanadi1414 Hopefully none… 😉

Simone, you've run into the "80, 80 rule of project management." That is, the first 80% of the project takes 80% of the time, and the last 20% of the project takes the other 80% of the time. Except that's overly optimistic.

@lightwaveez7416

4 жыл бұрын

It's always nice to have 160% Time for a project ;)

@OhhGeeGee

4 жыл бұрын

And don't forget to multiply the time estimate by pi.

@SandiskCruzer

4 жыл бұрын

You could just say the 80-20 rule: 80% of the project takes 20% of the time, the rest is vice versa, with the side-note you thought the first 80% would take 80% of the total time. That would be a more realistic approach. ;)

@greatscott9231

4 жыл бұрын

@@SandiskCruzer, the point of the 80, 80 rule is that no one can guess all the unknowns correctly. Plus pressure from management to reject the "realistic" schedule because it shows the project taking too long, and therefore they want a shorter schedule. The result is that _everything_ takes twice as long as you thought... if you're lucky. Typically the employees end up working massive amounts of overtime to hit the release date (engineers and managers are usually salaried, so 40 hours or 80, they get paid a flat rate per week). If you're unlucky then you end up trapped in a "death march project" (there's even a book by that name).

@AsphaltAntelope

4 жыл бұрын

Parkinson's law is the adage that "work expands so as to fill the time available for its completion". - en.wikipedia.org/wiki/Parkinson%27s_law

When I was younger I wished there was a reusable calendar like this. Definitely waiting for it to become orderable.

@adamblomberg

4 жыл бұрын

But you can't write notes on it. I see it more as a decorative item.

@MyYoyoyoyoyo12345

4 жыл бұрын

It is yeah, but it's nice to keep track of the days like that. I don't like writing notes like appointments on paper calendars anyway, prefer to keep reminders on my phone.

I can't stop laughing at the idea of having a new year's resolution to be more mysterious. I love it.

@GrinningGrey

4 жыл бұрын

I want to copy that resolution hard. 😂 Although, now it will be no mystery where the idea came from...

@TheSqoou

4 жыл бұрын

That's like making a plan to be more spontaneous.

Me: How you doing? Simone: Great! Me: So what have you been doing? Simone: MACARONI ART!!!!!!!

@SheepdogSmokey

4 жыл бұрын

I can't watch except on my phone which is tiny when at work, is she in remission again?

@treyfort4805

4 жыл бұрын

@@SheepdogSmokey yep. She gone straight crazy

"I don't know how we could have done this in real time without Dropbox!" Google docs: WTF?

@JPower172

4 жыл бұрын

Nah the google drive alternate versions of microsoft office have way less functionality.

@MrMario616

4 жыл бұрын

Git is would be even better, because you have a real history... And there's no chance of overwriting each others changes by accident

@Comhead1234

4 жыл бұрын

@@JPower172 Just link Google drive to any folder on you computer and upload your own word docs

@Lizlodude

4 жыл бұрын

If you are able to use the gDoc format, docs, sheets, etc., it's great, but as soon as you need to use something else, as I'm sure you would for board designs, code, forms, etc, it becomes a pain in the butt. Love Google Docs, but yeah some things its just not great at.

@MikeShyu

4 жыл бұрын

Because Dropbox is not banned in China. Google drive can’t be accessed without a VPN. If they were using Dropbox to keep their Chinese contacts up to date with the latest design drawings having a non VPN option is pretty important. Since the government can make VPN access difficult during politically sensitive events such as elections.

*Next version you should add a speaker that makes bubble wrap popping sound when you press something! You don't even need to have the dates on it, just digital bubble wrap! I'll sell you this idea for a check for $10,000 made of macaroni!*

@zippoblackburn3106

4 жыл бұрын

some things sound like a good idea - until one has children!

@alexsfilm-house3325

4 жыл бұрын

@@zippoblackburn3106 teach your children to behave then.

@TheLexiconDevils

4 жыл бұрын

Nah programmable sound bites ‘nailed it’

Thats some excellent macaroni art 👍

@TheCimbrianBull

4 жыл бұрын

Your profile picture is awesome! 😀

@Lea19822

4 жыл бұрын

TheCimbrianBull thanks 👌

@zaptor1514

4 жыл бұрын

Leanna Cox I thought it was fishbones strung together.

The macaroni art "Sorry" has 'meme material' written all over it

You are such an amazing human.

@daniel4647

4 жыл бұрын

Well that sounded genuine and not at all like you're promoting your channel, good job with the subtly there.

@arturoromero3166

3 жыл бұрын

Skin human*

Feb 29 should be a tiny little add-on thing with just that one button. :D

@mrtyman408

4 жыл бұрын

Kickstarter-exclusive, of course!

@kishinslayer2228

4 жыл бұрын

A small drawer pulls out with the button in it

So cool, congrats on the prototypes! If it's only a handful of units that have dodgy frames, I would tear those apart and make special custom framed units in your shop.

@TheSkepticSkwerl

3 жыл бұрын

From the ones I have seen photographed on her website, she redesigned the frames.

@couchpotat

2 жыл бұрын

why are there so few replys

"... and maybe I'll change the name at some point. I just don't know when a good time to do that is." Now! Much better to do it now rather than later. As the great Shia Labeouf once said; Don't let your dreams be dreams. Just, do it!

Simone, you’re my favourite skin human

@GrinningGrey

4 жыл бұрын

😂😂😂

@jakew3

4 жыл бұрын

So racist

@oneseeker2

4 жыл бұрын

A skin human?

@eliza1498

4 жыл бұрын

who's ur favourite meat human

@booty_hunter4207

4 жыл бұрын

@@jakew3 thought this was trolling but after looking at your other comments in seems that you're just stupid

Oh, I love your necklace.

Cool that you updated everyone Sometimes you don’t really hear about the behind the scenes stuff

@emc2mm

4 жыл бұрын

Do not send anything back - to China. I have done product development for years. It’s not worth it. It’s the problem with off shore production, But I have several ideas for solutions. If you have not figured out shipping I could help you figure out green solutions that the shipping monkeys can’t destroy and the earth will be happy too.

@superbeavers7645

4 жыл бұрын

@@emc2mm how does this relate to the comment?

Is there ever going to be a restock of the everyday calendar? I finally have a job to be able to buy stuff like this and I would love to use it for my pills

Improvement idea: another color for the last-clicked/current day.

@c0r3n

4 жыл бұрын

And if you press two second one day, its maybe light in blue¡ for mark a special day¡

@baitlord2932

4 жыл бұрын

Basically multiple color for marking P. S Also add a hold function to every day, to let you set to the current day P. S. S sync it with app

That necklace is dope. That calendar is fantastic. That macaroni art is top notch.

The "Light up my day" calendar.

Simone, you never have to feel guilty about asking people to watch your videos. They are all great and I always look forward to them. You are a fascinating, creative young lady and you are as cute as a basket of kittens. You look so healthy and happy now. It's great to see that after what you have been through. Congratulations on your new product. I am so happy for you! This made my day. : )

I love that they look like frames found in bee-keeping hives and that the buttons are HONEYCOMB SHAPED

That Dinosaur is DOPE

@piemaster6512

4 жыл бұрын

My girlfriend would love the shit out of that. I want one.

@runklrgurlexe

4 жыл бұрын

It used to be available on wickedclothes.com but they stopped selling jewelry 😭

@simonegiertz

4 жыл бұрын

It's from Tatty Devine: www.tattydevine.com/products/dinosaur-necklace-gold-2368

@terriblej6107

4 жыл бұрын

If you Google search "dinosaur necklace" its like the first result. Wish for a buck, Amazon for 7

@bluef1sh926

4 жыл бұрын

@@terriblej6107 If someone buys something for a gift, he should definitely stay away from Wish. You literally get what you paid for there, in the bad way.

Congrats on the progress thus far! Bummed I missed out on the first batch but will happily order once they become available. This is the ultimate KZreadr merch.

@AlexAlex

4 жыл бұрын

The term 'KZreadr merch' just cheapened the whole thing 😞

@JesseDriftwood

4 жыл бұрын

Alexatron it was a dumb joke relax

@daniel4647

4 жыл бұрын

@@JesseDriftwood You're a dumb joke, you relax

Calendars will be shipped February 29th, 2020. Ok, byyyeeeee.

Can't believe its been over 2 years since your surgery. YAY, keep on keeping on!

I thought I was wasting my time watching this video, but the macaroni art made it worth it. Apology accepted Simone ;)

February 29th is International Cheat Day

@bennylloyd-willner9667

4 жыл бұрын

Yeah, I was looking for this, I just couldn't be the only one wondering about Feb 29th. The next version of the calendar should have a Feb 29 popping up when needed (like proper mechanically completely hidden away "normal" years)

@EATSLEEPDRIVE2002

4 жыл бұрын

One day a year? Tell that to my ex-wife !

@whack6102

4 жыл бұрын

@@EATSLEEPDRIVE2002 one day every four years. February 29 only occurs on a leap year

@bennylloyd-willner9667

4 жыл бұрын

@Rebster ty for info, I'll check it out 👍

"You can print more dollar bills, but you cannot print more trust into this world". Wow, this hit me more than it should...

'Everyday calendar' is a great name! The whole point is that every day is on one panel, and you can see them all together. That's something unique and characteristic for your calendar. I think 'light-up calendar' is good too, but maybe too descriptive. I can tell it's light-up by looking at it, and the name doesn't add as much to how I see the product.

@booty_hunter4207

4 жыл бұрын

Someone else came up with busy bee calendar and I think its perfect!

maybe the best time to change the name is at the point you make them available for purchase? like this you have the first special backer version and the version to purchase :)

You could call it "the Lighten Up Calendar" as you made it to meditate and lighten up, and it also lights up.

Don't feel guilty. I love your videos. :) You're one of the most "real" youtube personalities I know of.

Your ted talk is literally on my school curriculum to teach us about creativity! I was mentally screaming when my teacher put it on!

_opens Toucheroni Calendar and a bunch of sand comes out_ What the...beach?

You don’t know what a business body is? It’s the body of a mantis shrimp!

I really LOVE this! I signed up to be notified when I can purchase one. You ROCK!

Gonna predict this now: there will be stop-motion everyday calendar light animation videos within exactly 1 minute of these amazing creations arriving in the hands of the backers. And I will gladly watch them! Congratulations! They really are stunning!

I think you should call it something in the lines of "Brighter future calendar" because you use it to develop healthy habits, and every time you do so, you turn on a light. The calendar that brightens up every day of your life. It ain't perfect yet, but you get it!

Don't feel guilty!! I LOVE your videos. Your quirky humor and upbeat attitude always makes my day so much better. :) Thank you for sharing a bit of yourself with all of us

2:51 my "A-ha!" moment when I finally realized what her necklace was and felt extremely stupid for not realizing something so obvious earlier.

that segway into the ad part was flawlessly awesome. well done, simone!

Omg that necklace! Also, I would love an automated calendar like that. Looks dope af!

You weren't asking for money. You put out a product that you thought people genuinely enjoy and people bought it. In fact this could help out alot of people who lack motivation in their goals. So thanks for the sweet calendar.

Honestly really excited for these coming into the world. It's such an instant gratification of see the things light up and you get such a pretty picture at the end. This is going to hell a lot of people for healthy habits and meet their goals. It's also such a great reminder to do the thing. A lot of issues I run into when trying to start a new routine is to just remember it in the first place.

1.5 year is insanely quick for such a product! Very well done to you and your team!

Simone, I just want to say that you inspire me everyday! I'm a female mechanic, and I take great joy out of seeing your engineering skills put to work. We need more women like you!💞🤘😘

@suprstraight2421

4 жыл бұрын

What skills? xD

@tanmaypanadi1414

4 жыл бұрын

@@suprstraight2421 I agree she is more of an entertainer Most of these skills don't fall under mechanically they are general tools of any creators trade .

As a charter member of the Society for the Preservation of the Marconi Arts, I want to applaud your efforts in spreading the word for our cause. Thanks Simone.

@straybricks

Жыл бұрын

Macaroni? Marconi contributed to the invention of radio.

So happy you're looking so clear and well. It's a fabulous product, beneficial and beautiful. Much respect and celebration.

I like the idea of getting one day off from meditating every forth year.

Whatever Simone wants Simone Giertz ;)

@nothanks7752

4 жыл бұрын

but it's pronounced yetch.

@lovecinnamonxx

4 жыл бұрын

@@nothanks7752 yes...but no😂

@ValtintimeGaming

4 жыл бұрын

CaveNerd 😂🙈

@cavenerd

4 жыл бұрын

@@nothanks7752 ...I know but..... :)

@BrilliantDesignOnline

4 жыл бұрын

I see what you did there

As a product development engineer, I feel the "you think you're three weeks away, but then remember that's how you felt 5 months ago" sentiment. It can be so soul-crushing and frustrating at times but the first time you hold that thing you made in your hands

When you stroked them and got the emotions.....me too. Great work, Gertzy.

I love the aesthetic of this calendar so so much and at some point i will hopefully own one myself. I love glowy things and ive gotten so much into bullet journalling lately

Seeing how much love, care, and effort you put into the every day calendar (and everything else you do) inspires me to do the same in my own day to day life. Thank you for being you! ❤️ Sending love!

Well done you should be so proud it's a fantastic product I would love one x great job xx

Yep. Simone, you are an ace human being. Keep up the good work!

This looks really really pretty!!!! I'm super happy things are working out :)

Thank you for being honest about Crowd Funding goals not having any connection to reality. Would you have been able to produce and ship if you just reached the goal?

I love this video, having it broken down like this was really awesome to see. And congrats on an awesome project! (The calendars loooook amazing btw!)

Vilken otrolig resa du har gjort och gör med allt vad det innebär. Så kul att följa!

I never saw that awesome necklace before until I saw you wear it. My time wasn't wasted here, thanks Simone!

I was just looking at that necklace the entire time, I love it!

@Judah.Rosenthal

4 жыл бұрын

Me too! Looks like a walking bird. Without a head.

@sparthir

4 жыл бұрын

I know right? Awesome necklace.

Yeah, the calendar... BUT YOUR NECKLCE OH MY GOD ITS BEAUTIFUL

It is heartwarming to see how people reward someone who is transparent, sweet and sincere.

So happy to be earlybird, looking forward to it! Big thumbs up for the endeavor and showing the 'make' phylosophy is still alive!

You know what lights up my day, a new Simone video.

"Everyday Calendar" is perfectly fine for the name. There's nothing wrong with it. At all.=)

@MasterTypoDemon

4 жыл бұрын

Is it really an "everyday" calendar if it doesn't include Feb 29th? That makes it seem like it's an everyday calendar 3 out of every 4 years.

@kporter85db

4 жыл бұрын

You should call it the Almost Everyday Calendar.

@MarcoNoPolo

4 жыл бұрын

@@MasterTypoDemon I think more people would complain about that 1 day not being lit up for 3 years. Including myself. Your eye would always been drawn to it. It would make it look incomplete. (IMO)

@alex.cristescu

4 жыл бұрын

@@MarcoNoPolo You could've lit it up with the 28th in those 3 years... for your OCD :)

@solarprogeny6736

4 жыл бұрын

@@MarcoNoPolo there should be a removable black hexagon at the bottom of february which you can remove to insert the 29th button every 4 years

I've had a very bad week and I was just laying in my bed relaxing to Bon Appetit vids when I saw that you have a new one and I immediatly dropped everything. I actually cried a little (a bad week, remember, I'm v emotional right now) when you pulled out that macaroni art with the word "Sorry" on it.

Simone, this is first vid I have seen of yours in many months. Nice to see you active! I hope your health is doing better? NorthAmerica ( Canada especially!) Loves you and what you keep doing!

I am so stoked for this calendar!!

If the "queen of shitty robots" thing falls through for some reason, "macaroni artist extraordinaire" might be a good backup.

Don't feel guilty Simone, you are entertaining us whether its about your calendar or your TruckLA or even a simple update on one of your many inventions. We love to see you, you seem to be a very interesting person.

i tried a crowdfunding thing awhile back and it was a horrendous embarrassment (long story, rushed, not prepared, ect.) but this gives me hope that my other idea I'd like to bring to market might stand a chance at success. You put into words so many things I felt, like asking for help. I myself am usually the one helping, not needing or getting help. So to ask for stuff like that almost comes with a level of guilt. I really appreciate you taking the time to make this video. Gives some of us hope and thank you.

I like to think that there's an easter egg or two built in if you press a specific sequence of numbers. :-)

Next thing you know china’s Put out a “each day calendar “ for $100 that looks *suspiciously* similar...........

@MatthiasTTV

4 жыл бұрын

I mean yeah, there's no reason this thing needs to cost $300.

@witgangyounotube287

4 жыл бұрын

@@MatthiasTTV reason was unknown variables for small batch manufacturing, if the thing goes viral then yeah i could see it drop to 100$. would you rather have projects be more reasonable priced and fail to deliver to all backers because the manufacturing price they estimated was lower than what they had to pay?

@Mickeystwin33

4 жыл бұрын

@@MatthiasTTV They weren't just paying for the product though. They were also backing the product and helping to pay for production

@suprstraight2421

4 жыл бұрын

Rather 10$ , the materials for this piece of crap coated 2$

@ragamuffin1588

4 жыл бұрын

@@suprstraight2421 Do you actually think the materials cost $2 ?

I think it's going to be very helpful for people to stick to a daily regimen and develop healthy routines. It's sooo good to see your face again, Simone!!! Vancouver loves you!

"You Push My Buttons" calendar. 😇😂

Simone... I SO LOVE that necklace! Well done on the campaign, the Calendar... and being the fabulous YOU that you are! Virtual High Five and Ghost Hug :-)

OKAY everybody: If Disney can have Disneyland, then I feel Simone can have the "GIERTZ CALENDAR" Who's with me on this??

@ribbitgoesthedoglastnamehe4681

4 жыл бұрын

If it includes standard -length months and decimal weeks, I am in!

I'm really happy to see you doing well. Cheers!

Dude, fantastic vlogs, thank-you.......love the humour.TED talk brill.

Please can we get a kit form, for people who like to solder and listen to BigClive?

Simone just pushed my birthday. You the best June 3rd!

I didn't have a resolution until seeing this. I will join you, but also give you a hand. I am now, also, going to be more mysterious. I am not going to say I am being mysterious, I am going to say stuff like "I have made some kind of important commitments for the new year, but I am not at liberty to discuss any of it at this time." You can add an apology if you feel you need to, I, however, do not feel that need. If you just can't have this resolution without telling everyone, then when you do tell everyone, you have to laugh and act like youre faking. Then it is still kinda mysterious.

Happy Birthday Simone!

I hope they really do fix the blemishes, like wonky corners and such. For this pricetag, the backers absolutely deserve something that looks great, and they shouldn't settle for less just because they also enjoy Simone's other work.

Macaroni art is not legally required... but should it be? Geirtz 2020

Just discovered your youtube channel today, every video ive watched so far has been fantastic, 10/10 good jobs - well done - do it to it, great hair bro

2021 also needs a batch of these, I'd even take one with "defects" as you call them, that's how much I love the idea and passion behind it.