Darknet OPSEC Bible 2022 Edition

Ғылым және технология

₿💰💵💲Help Support the Channel by Donating Crypto💲💵💰₿
Monero
45F2bNHVcRzXVBsvZ5giyvKGAgm6LFhMsjUUVPTEtdgJJ5SNyxzSNUmFSBR5qCCWLpjiUjYMkmZoX9b3cChNjvxR7kvh436
Bitcoin
3MMKHXPQrGHEsmdHaAGD59FWhKFGeUsAxV
Ethereum
0xeA4DA3F9BAb091Eb86921CA6E41712438f4E5079
Litecoin
MBfrxLJMuw26hbVi2MjCVDFkkExz8rYvUF
Dash
Xh9PXPEy5RoLJgFDGYCDjrbXdjshMaYerz
Zcash
t1aWtU5SBpxuUWBSwDKy4gTkT2T1ZwtFvrr
Chainlink
0x0f7f21D267d2C9dbae17fd8c20012eFEA3678F14
Bitcoin Cash
qz2st00dtu9e79zrq5wshsgaxsjw299n7c69th8ryp
Etherum Classic
0xeA641e59913960f578ad39A6B4d02051A5556BfC
USD Coin
0x0B045f743A693b225630862a3464B52fefE79FdB
Subscribe to my KZread channel goo.gl/9U10Wz
and be sure to click that notification bell so you know when new videos are released.

Пікірлер: 1 100

  • @rpeetz
    @rpeetz2 жыл бұрын

    You know what defeats strong full disk encryption? $5 wrench hitting you until you unlock it.

  • @rajasekharareddy4584

    @rajasekharareddy4584

    2 жыл бұрын

    Classic and effective 👏👏👏. 😂😂😂

  • @YerBrwnDogAteMyRabit

    @YerBrwnDogAteMyRabit

    2 жыл бұрын

    Rocks are free. Save the $5 for a latte.

  • @ireallyreallyreallylikethisimg

    @ireallyreallyreallylikethisimg

    2 жыл бұрын

    A hotkey to zero write ;)

  • @spamlogs2701

    @spamlogs2701

    2 жыл бұрын

    Killswitch big brain play

  • @ArthursHD

    @ArthursHD

    2 жыл бұрын

    If it automatically boots like Windows you can deprive it from updates and reverse shell into it with a known exploit. Completely bypassing encryption :D In that way LVS and VeraCrypt is better than BitLocker standard implantation. Quickest wipe is to blow up NAND chip in seconds. Could also modify the package and fry it with an electric ⚡ arc 😄

  • @sethh9550
    @sethh95502 жыл бұрын

    Mental Outlaw please never stop making videos, im going to college for comp sci next you and you are a HUGE inspiration. Keep up all the content even workout/meal vids all amazing.

  • @MentalOutlaw

    @MentalOutlaw

    2 жыл бұрын

    Thanks, good luck with your classes and remember to network!

  • @bubbleboy821

    @bubbleboy821

    2 жыл бұрын

    The real value of college

  • @J43rv1

    @J43rv1

    2 жыл бұрын

    Stay woke, avoid college, get certs and xp instead - it's the MO way

  • @newtonbomb

    @newtonbomb

    2 жыл бұрын

    @@phillipanselmo8540 I'll tell you what, my local state university comp sci/engineering department sure was a pretty garbage experience...

  • @J43rv1

    @J43rv1

    2 жыл бұрын

    @@phillipanselmo8540 I'm not saying I agree but Mental Outlaw made a video about this exact problem, in case OP hasn't seen it

  • @Action2me
    @Action2me2 жыл бұрын

    “And it’s really popular on dread” 7 upvotes

  • @animepussy8356

    @animepussy8356

    2 жыл бұрын

    Meow

  • @user-el4su7tl6f

    @user-el4su7tl6f

    2 жыл бұрын

    That's like 700 upvotes on read-it

  • @someweeb3650

    @someweeb3650

    2 жыл бұрын

    @@user-el4su7tl6f that's still not much

  • @vladaguljas4258

    @vladaguljas4258

    2 жыл бұрын

    @@someweeb3650 Hi still, whos much?

  • @xd-mw4kx

    @xd-mw4kx

    2 жыл бұрын

    Mass majority of people don't sign in or have an account

  • @WarLordN1k
    @WarLordN1k2 жыл бұрын

    USPS tracking normal packages with tor sounds like my kind of trolling.

  • @nothing_

    @nothing_

    2 жыл бұрын

    It sure does.

  • @meganlettiere4386

    @meganlettiere4386

    2 жыл бұрын

    ikr

  • @eac-ox2ly

    @eac-ox2ly

    2 жыл бұрын

    Imagine if someone made a bot to somehow retrieve tens of thousands of USPS tracking numbers and then automatically looked them up with tor. That would be some fancy obfuscation.

  • @WarLordN1k

    @WarLordN1k

    2 жыл бұрын

    @@eac-ox2ly I think you have a wonderful idea right there.

  • @eac-ox2ly

    @eac-ox2ly

    2 жыл бұрын

    @@WarLordN1k 😈

  • @quiteafancyemerald
    @quiteafancyemerald2 жыл бұрын

    I just love how informative this is. Not like I would do anything ever related to this but keep making unique interesting content :)

  • @vsnusv7555

    @vsnusv7555

    2 жыл бұрын

    surely

  • @TheSuperBoyProject

    @TheSuperBoyProject

    2 жыл бұрын

    Oh, I would never *wink* *wink*

  • @hanabiilesley

    @hanabiilesley

    2 жыл бұрын

    i mean, either you initially create really informative recourse, or don't even attempt since even smallest mistake could cause smb huge problems

  • @yallugly4317

    @yallugly4317

    2 жыл бұрын

    I certainly do lol gotta love the vendors

  • @Riftio617

    @Riftio617

    Жыл бұрын

    thats what they all say

  • @midimusicforever
    @midimusicforever2 жыл бұрын

    What's needed and what's not depends on the threat model. Always start there!

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca2 жыл бұрын

    Wrapping packages in tinfoil in public bathrooms seems disturbing enough to make people notice and possibly call the police. It’s kind of like wearing a mask when picking up the package: sure it inconveniences any law enforcement tracking the package, but it also alerts the normal law enforcement of possible robbery…

  • @julianbinder2371

    @julianbinder2371

    2 жыл бұрын

    luckily there's covid masks now, just make sure to look like a liberal If you live in a very conservative area where a mask would be unusual

  • @ArthursHD

    @ArthursHD

    2 жыл бұрын

    There are silicon masks 😷 that look like $ex doll faces 😄 Pretty realistic if you ask me. :)

  • @meganlettiere4386

    @meganlettiere4386

    2 жыл бұрын

    Wearing a mask is normal nowadays because of the pandemic, actually.

  • @a_wild_Kirillian

    @a_wild_Kirillian

    2 жыл бұрын

    There are cabins in public bathrooms, you know.

  • @meganlettiere4386

    @meganlettiere4386

    2 жыл бұрын

    @@a_wild_Kirillian what do you mean?

  • @fancywaifu9821
    @fancywaifu98212 жыл бұрын

    I’m going into college next year for computer science and cybersecurity. I’ve already been studying in these fields for a while now. The more I learn about cybersecurity, the more I want to take more action in my life to make my life private and secure. Your a big inspiration mental outlaw!

  • @mineis3andhalfinches865

    @mineis3andhalfinches865

    2 жыл бұрын

    I hope you succeed, cybersecurity is cool as hell. Im currently saving to take courses for networking and kali linux. mental outlaw got me into this after watching his vid about mcafee getting shwacked a year ago

  • @fancywaifu9821

    @fancywaifu9821

    2 жыл бұрын

    @@mineis3andhalfinches865 Definitely a good field to get into!

  • @whannabi

    @whannabi

    2 жыл бұрын

    My man's gotta get big money

  • @Concise_Parakeet

    @Concise_Parakeet

    2 жыл бұрын

    @@whannabi lmao

  • @imonjenkem

    @imonjenkem

    Жыл бұрын

    going into college but cant use the proper youre form kek

  • @crabbyboi9127
    @crabbyboi91272 жыл бұрын

    i feel like just watching these vids have put me on a government watch-list

  • @andybuscus383

    @andybuscus383

    Жыл бұрын

    Guess you just gotta follow these steps so the government can't watch you anymore.

  • @jer1776

    @jer1776

    Жыл бұрын

    Same lol, Im just an IT Networking/Cybersecurity major who finds this stuff fascinating. Wouldnt pass up working for the Feds if I had the chance.

  • @crabbyboi9127

    @crabbyboi9127

    Жыл бұрын

    @@jer1776 ha ha yes me too ha ha (are the feds gone yet?)

  • @Conorscorner

    @Conorscorner

    Ай бұрын

    ​@@jer1776uh huh, Sounds like a carefully crafted alibi that a Super Dark Net Hacker Lord would say.

  • @Conorscorner

    @Conorscorner

    Ай бұрын

    ​@@crabbyboi9127Of course, we're too busy going after politicians, the mega wealthy and corporations to pay attention to unimportant stuff on here.

  • @olivialambert4124
    @olivialambert41242 жыл бұрын

    I think its incredibly interesting to learn about. But personally I just eat my bugs and live in my pod. I can't deal with the hassle this entails. But god bless you guys fighting the good fight to avoid mass surveillance and huge governmental overreach.

  • @eac-ox2ly

    @eac-ox2ly

    2 жыл бұрын

    This made me cackle. Thanks.

  • @olivialambert4124

    @olivialambert4124

    2 жыл бұрын

    @Zero One I'd like to hope so too. Perhaps if I search some naughty words I might get my own NSA friend. I do wish he reached out for a chat over covid though, it might have made both me and my agent a little less lonely over that year. Hopefully he likes computer games. I can get my very own government mandated stream viewer without even paying for big follows.

  • @damazywlodarczyk

    @damazywlodarczyk

    11 ай бұрын

    @@olivialambert4124 what kind of bullshit is this

  • @s4ms3piol30
    @s4ms3piol302 жыл бұрын

    Hey Mental, I just wanted to say that I'm studying computer science at university and want to pursue a career in security, And your videos have been a tremendous help! Especially the way you simplify complex attacks in layman's terms, I'm surely going to credit you in my Graduation speech! Love ❤️

  • @fahimp3

    @fahimp3

    2 жыл бұрын

    Or Mental could be a CIA honeypot... Just saying. Also I found "A Graduate Course in Applied Cryptography " by Dan Boneh and Victor Shoup very helpful in understanding the computer science side of things. It is available as a free pdf online.

  • @s4ms3piol30

    @s4ms3piol30

    2 жыл бұрын

    @@fahimp3 thx

  • @Sombre____

    @Sombre____

    2 жыл бұрын

    Advice : Don't buy Hak5 device. :)

  • @s4ms3piol30

    @s4ms3piol30

    2 жыл бұрын

    @@Sombre____ i hate em anyways

  • @Sombre____

    @Sombre____

    2 жыл бұрын

    @@s4ms3piol30 Good. Because it's script kiddies stuff or the best way to get caught. They resell opensource stuff in a shiny box with their name. They will be the first to snitch you if the feds ask them question.

  • @TIOLIOfficial
    @TIOLIOfficial Жыл бұрын

    6:25 - As far as the Ross Ulbricht library situation, it wasn't that he was "trying to he a hero", as you once said". Here's what actually happened: two officers created a fight. When Ross was sitting in the library with his laptop, the agents knew they could not just rush him, cause he most likely would have just hit the kill switch. So what happened was that the 2 agents started a fake fight and when at one point when of them raised their voice, Ross turned around to look. Unfortunately, that split second of our natural reaction was all it took for a third one to grab the computer, while the others grabbed Ross himself. Ross didn't walk over to anyone, he didn't try to "play the hero", as you once said.

  • @donovantheghost4179

    @donovantheghost4179

    11 ай бұрын

    Use a laptop with out a charger. 😅

  • @stigcc

    @stigcc

    4 ай бұрын

    If you have Tails with a string attached to your wrist and the usb drive, it would be a physical kill switch.

  • @aZebruh
    @aZebruh2 жыл бұрын

    “Yes officer unfortunately that $100k in bitcoin was lost in a boating accident :(“ Edit: If you liked my comment, also like the video, cause its really his joke not mine😉

  • @chrishears

    @chrishears

    2 жыл бұрын

    Catfish got it bruh.

  • @mrbanana6464

    @mrbanana6464

    2 жыл бұрын

    You can have the greatest opsec in the world but mysterious crypto transactions, especially in large amounts, won't be getting past the IRS. Always pay your taxes.

  • @Cookiekeks

    @Cookiekeks

    2 жыл бұрын

    @@mrbanana6464 Not even the IRS can track monero transactions

  • @joey199412

    @joey199412

    2 жыл бұрын

    @@mrbanana6464 IRS put a seething bounty on cracking Monero because they actually can't track it.

  • @mathisblair2798

    @mathisblair2798

    2 жыл бұрын

    @GENDER EQUALITY IS A MYTH tis why I never set foot in the ocean. We evolved from sea to land not vice versa I say.

  • @yb7875
    @yb78752 жыл бұрын

    Im glad this channel is getting more views. The more viewers this channel has, the less suspicious a person is for watching it, people are increasingly more likely to be normies instead of privacy nuts. Keep it up, been here for a while, and yours is better than the rest.

  • @yb7875

    @yb7875

    2 жыл бұрын

    I know its not the sort of thing you usually do, but I looked up tutorials on yagi antennae wifi extension and its very lacking. It sure would be good if there was one on youtube, made by a reliable guy..

  • @mathisblair2798

    @mathisblair2798

    2 жыл бұрын

    I have to give Denshi an honorable mention too now and again, perhaps for more recreational knowledge.

  • @richardlamm4826

    @richardlamm4826

    Жыл бұрын

    I've never been called a normie before.

  • @jakdamkatnia5335
    @jakdamkatnia53352 жыл бұрын

    Always happy to see a mental outlaw post, i'm working on my cybersecurity certs, and you help keep me up to date on the latest security news and tips :)

  • @Mildewpants
    @Mildewpants2 жыл бұрын

    Not even watched this yet, but know it will be very useful, and looking forward to watching it ASAP! I tend to blather on a bit when explaining OPSEC and other important internet security measures...but if I send a link to your vids in a groupchat at least one person will watch it which gets the ball rolling. Nobody tends to belive me that just paying for a VPN is not really a solution to anything lol.

  • @thegamefanaticshow
    @thegamefanaticshow2 жыл бұрын

    A fantastic method of physical security is to get a usb drive that can securely connect to a lanyard. Find a lanyard that can securely STAY wrapped around your wrist. Make sure lanyards long enough to use the laptop while securely connected to your person and USB drive. Tada now you got a dead man’s switch, at any time that machine is separated from you instawipe!

  • @delchodimitrov9439
    @delchodimitrov94392 жыл бұрын

    "Don't talk about Dark Web in public!" -- Mental Outlaw :~70% of his vids - talking about things related to the dark web -- Mental Again :D

  • @blackninja9400

    @blackninja9400

    2 жыл бұрын

    We suspecting this channel is some honeypot for feds. Why? Why Google allow this on KZread?

  • @kim-hendrikmerk4163

    @kim-hendrikmerk4163

    2 жыл бұрын

    Means he probably isn't using it. Or he has some mind boggling strategy that we are too simple to understand.

  • @wontcreep

    @wontcreep

    2 жыл бұрын

    the technique is to only talk about things you don't REALLY do :))) and shutting up about the spice

  • @egarcia1360

    @egarcia1360

    2 жыл бұрын

    As in, don't talk about your dark web activities in public because you could incriminate yourself. His content is just for educational purposes ;)

  • @e3.14c4

    @e3.14c4

    2 жыл бұрын

    Not what that's supposed to mean. Like if you go watch an illegal boxing match (if those still exist, or ever existed on the internet, just pulling an example out of fiction to stay pg), and then tell all of your buddies you saw someone get their face tore open by brass knuckles. Every piece of information you emit, is a liability.

  • @azatecas
    @azatecas2 жыл бұрын

    i love your opsec videos, great balance of comedy and good advice.

  • @ivanivanovich231
    @ivanivanovich2312 жыл бұрын

    "at this point we've entered tinfoil territory" bruh as if everything before that wasn't?

  • @lightyagami1752

    @lightyagami1752

    2 жыл бұрын

    From that point on it was *literal* tinfoil territory.

  • @bruh-db8by

    @bruh-db8by

    2 жыл бұрын

    it isnt tho bro

  • @alreaud

    @alreaud

    2 жыл бұрын

    @@lightyagami1752 Maxwell's 2nd law. Go buy an AirTag and try it out. I used to run a lab at a company that made data conversion products. We had a real Faraday cage, big. We didn't use tin foil, we used a copper mesh. Two layers, separated by a 2x4 and grounded to earth ground. The test was tune the strongest local FM radio station and shut the door. Static...

  • @laststand6420

    @laststand6420

    Жыл бұрын

    @@alreaud Would that still work without grounding?

  • @benneilsen2915
    @benneilsen29152 жыл бұрын

    He makes a lot of points of not using your home WiFi, but if you want to protect your other devices, just segment it. If you're firewall-savvy you can make a separate subnet for risky devices and install strict host firewalls on them.

  • @S_Roach

    @S_Roach

    2 жыл бұрын

    There is a saying, "Don't S* where you eat." That's why you don't want to use your own WiFi. Turning logs off on your router won't matter if they already know your address was involved.

  • @bluegizmo1983
    @bluegizmo19832 жыл бұрын

    if your gonna take the package somewhere else to open it, write "return to sender" on the outside of the package immediately upon receiving it, so if they grab you as soon as you leave the house, your just taking it to the post office to return it as you didn't order anything.

  • @BrandonCurington1

    @BrandonCurington1

    Жыл бұрын

    thats actually genius

  • @Tor010

    @Tor010

    Жыл бұрын

    They never do that, they will just get you too sign on delivery and then let themselves be known,

  • @beagleonvodka
    @beagleonvodka Жыл бұрын

    Mental Outlaw You're one of my favorite cyber sec channels, each time you upload a video I am compelled to watch. Keep it up 💯!!!

  • @4erepX
    @4erepX2 жыл бұрын

    Good guide, but the thing is , you can achieve decent security from any device if you just SSH to a dedicated server (rented using monero or any other anonymous method) and by using some tor/proxychains . You can change this servers like once in a week or month (depending on your business). And to avoid being compromised u can just setup your own VPN server that will act like a bridge between your PC and Wi-Fi router. So your PC won’t connect to the Wi-fi manually, traffic will always go through some Raspberry PI with VPN on it. Plus you can just carry it around with you and use it with Public Wi-fi which will make really hard for anyone to identify your activity.

  • @KristophM
    @KristophM2 жыл бұрын

    You're a legend, Kenny! Over a decade ago I tried Ubuntu just for the hell of it and I hated it. But after finding your channel, you're the sole reason I ditched Windows and got into GNU/Linux again. And I've gone down the rabbit hole. Currently BTW I use Arch, lol 😎

  • @sirzorg5728

    @sirzorg5728

    2 жыл бұрын

    How do you know who uses arch? They will tell you within 5 minutes of meeting you.

  • @mathisblair2798

    @mathisblair2798

    2 жыл бұрын

    @@sirzorg5728 It's true, for you see, tis I, who also is an user of thee arch, verily.

  • @JamesWilson01

    @JamesWilson01

    2 жыл бұрын

    @@sirzorg5728 Vegans too. They should do a study on the correlation of Arch usage to veganism. It would be a good use of public money.

  • @0xC47P1C3

    @0xC47P1C3

    2 жыл бұрын

    Kung Fu Kenny at it again

  • @Gilbert2988

    @Gilbert2988

    2 жыл бұрын

    how much do you weigh?

  • @Jango1989
    @Jango19892 жыл бұрын

    "We're not going to discuss rugs" this took me a long minute😅🤣🤣

  • @rogainegaming6924

    @rogainegaming6924

    2 жыл бұрын

    i dont get it.

  • @rogainegaming6924

    @rogainegaming6924

    2 жыл бұрын

    @@MrZZ-py4pq Now I get it.

  • @JamesWilson01
    @JamesWilson012 жыл бұрын

    Ah, Dread. Always a good wholesome read! Everything from security gods to insanely paranoid dudes trying to score their first gram to kids making death threats against hardcore criminals 🤣 This "guide" went from some James Bond sh*t to the most stupidly obvious way to get phished. Nice job on pointing out the flaws 👍 Btw Tails doesn't come with a Monero wallet which made me think that could be the glow boys target no.1 for trojanizing the OS. Keep up the good work man!

  • @s4ms3piol30

    @s4ms3piol30

    2 жыл бұрын

    the security gods on dread are really gods

  • @JamesWilson01

    @JamesWilson01

    2 жыл бұрын

    @@s4ms3piol30 Worshipped daily by many tens of people 🤪

  • @KManAbout

    @KManAbout

    Жыл бұрын

    Carcano > monaro

  • @KB-nt7eg

    @KB-nt7eg

    Жыл бұрын

    @@KManAbout you mean cardano and monero? How broke are you? Lol

  • @KManAbout

    @KManAbout

    Жыл бұрын

    @@KB-nt7eg smartphone keyboard broke

  • @1xadavid
    @1xadavid2 жыл бұрын

    Mental, you are the only channel I turn on notifications for on KZread. Your videos are that dope. Thank you, and please keep them coming.

  • @yourlocalcyborg
    @yourlocalcyborg2 жыл бұрын

    10/10 tutorial as always, my good man! Keep up the fantastic work

  • @thekeyboard11

    @thekeyboard11

    2 жыл бұрын

    Yeah, 10/10 tutorial about getting darknet goods shipped to your house

  • @ArthursHD

    @ArthursHD

    2 жыл бұрын

    Tried to post a few things not mentioned, but KZread keeps detting my comments :( Too sensitive :D Base64 encoded comment for the algorithm (: V2h5IHdvdWxkIFlvdXR1YmUgcmVtb3ZlIG15IGNvbW1lbnQ/CkJpcXVhZCB5YWdpIGlzIGEgbmljZSBoaWdoIGdhaW4gYW50ZW5uYS4KVXNlIHVuaXF1ZSBlbWFpbCBhZGRyZXNzZXMsIEFjY291bnQgbmFtZXMgZm9yIGVhY2ggYWNjb3VudC4gd2lsbHdoaXRlIC8gZnJlZW1haWwgb24gR2l0aHViIGhhcyBhIGxpc3Qgb2YgZnJlZSBlbWFpbCBzZXJ2ZXJzCklmIHlvdSBwb3N0IGNyeXB0byBhZGRyZXNzZXMgZG9uJ3QgcmV1c2UgdGhlbS4KSWYgeW91IHVwbG9hZCBwaG90b3Mgb3Igb3RoZXIgY29udGVudC4gUmVtb3ZlIHNlbnNpdGl2ZSBpbmZvIGFuZCByZW1vdmUgRVhJRiBkYXRhIGxvY2FsbHkgb24geW91ciBkZXZpY2UuCkRvbid0IGdldCB0b28gYmlnLiBDaGFuZ2UgbmFtZXMuCkNvdWxkIG1lbHQgTkFORCBjaGlwcyB3aXRoIHB5cm90ZWNobmljcy4gRGFya25ldCBEaWFyaWVzIEUgMzkgaXMgYWJvdXQgdGhhdA==

  • @axelaxel3156

    @axelaxel3156

    2 жыл бұрын

    @@thekeyboard11 huh?

  • @maximilian200057

    @maximilian200057

    2 жыл бұрын

    Who is that girl in your pfp?

  • @ericm8502
    @ericm85022 жыл бұрын

    Great video as always! Teaching valuable cyber security knowledge to this generation of zoomers!

  • @Gabriel-_-245
    @Gabriel-_-2452 жыл бұрын

    Is it only me who watches this content without any intention whatsoever to do anything remotely illegal now or in the future?

  • @holthuizenoemoet591

    @holthuizenoemoet591

    2 жыл бұрын

    nope, its just facinating. I think its a bit like the seccond amendment for americans (im from the EU) where they feel that guns help protect them from the goverment

  • @nunyabiznes33

    @nunyabiznes33

    Жыл бұрын

    I know 0 shit about tech but I still watch his vids every now and then.

  • @carl6825

    @carl6825

    Жыл бұрын

    You're not alone, to me it's kind of like watching a true crime documentary, tinfoil stuff is always funny too like "wrap your package in tinfoil broOo0!!1!"

  • @ekremaslan8068

    @ekremaslan8068

    Жыл бұрын

    of course, sir, I'm also a law abiding citizen just like you, I'd never do anything of the sort.

  • @dinky82920

    @dinky82920

    Жыл бұрын

    @@ekremaslan8068 Me too!

  • @trapOrdoom
    @trapOrdoom2 жыл бұрын

    One of the smartest and most informed, arguably most important KZread channel.

  • @gregbagel791
    @gregbagel7912 жыл бұрын

    As a brand new cyber security masters student, I will watch this channel’s career with great interest

  • @lavavex
    @lavavex2 жыл бұрын

    I love watching these videos that put me on the fbi watch list, lol. But great vid man, I love cyber security and opsec stuff!

  • @uwu
    @uwu2 жыл бұрын

    thank you for everything you do

  • @24hourtourist
    @24hourtourist2 жыл бұрын

    Wow I'm surprised the YT gods have not pulled this yet as you're posting Darknet bulletin boards, Mental. Good info as always!

  • @diogosequeira5926
    @diogosequeira59262 жыл бұрын

    Even as a law student I absolutely love your videos, don’t ever stop making those

  • @Griimnak
    @Griimnak2 жыл бұрын

    Having a separate laptop is good because it isolates your main hardware fingerprint from your deepweb hardware fingerprint. Example, if you're on windows cmd: wmic baseboard get product,Manufacturer This fingerprint of your board is traceable cross OS. If you only use one device and it is confiscated on basis of suspicion, they can confirm you are the person of interest via hardware fingerprint. Changing mac and etc wouldn't matter.

  • @Shuroii

    @Shuroii

    2 жыл бұрын

    KVM doesn't set those by default and it becomes "generic vendor" across the board

  • @jer1776
    @jer1776 Жыл бұрын

    Doubt I'll ever have a use for half this info but love to learn about it. Great video

  • @dickbrocke
    @dickbrocke11 ай бұрын

    Any joking aside though, the person who authored this excerpt from the OPSEC Bible (being a passage from the Book of Online Ordering) really did put a lot of effort into it. Without going into too much detail, I hear from a reliable source that he completed it just before he finally caved (as most vigilant and watchful precaution takers in his position probably would). They say that he is now in a much calmer environment, and that the head monk at the monastery only allows the brethren to utter ten words a year, as a Christmas treat.

  • @misty2k645
    @misty2k6452 жыл бұрын

    im not in this field at all, im an accountant lmao, but i love just listening to you speak all these words hahah keep up the greats vids man

  • @YitzharVered
    @YitzharVered2 жыл бұрын

    I'm currently being sucked into the world of computers and programming all at once it it's quite jarring. I'm trying to learn everything from computer and cpu architecture, selenium web scraping, computer science basics as well as all this tor stuff. This is probably not the best approach I know, but there's so much to learn!

  • @Laurens115
    @Laurens1152 жыл бұрын

    Why is your content always SO good and SO consistent??

  • @KrisAkaVenno

    @KrisAkaVenno

    2 жыл бұрын

    Shrigma grindset ofc

  • @animepussy8356

    @animepussy8356

    2 жыл бұрын

    Meow

  • @rbda8921

    @rbda8921

    2 жыл бұрын

    @@KrisAkaVenno Shredded sys admin that uses gentoo in personal laptop, literal gigachad sigma based. My guy IS the steryotype

  • @spamlogs2701

    @spamlogs2701

    2 жыл бұрын

    Unlike network chuck he isnt a sensationalist i like it

  • @animepussy8356

    @animepussy8356

    2 жыл бұрын

    @@spamlogs2701 Cat Man vs Network Chud

  • @Tallero
    @Tallero Жыл бұрын

    even small museums are being offered tools for ai powered visitor tracking from the camera feed. So public route could really be less secure than one thinks. Fascinating stuff.

  • @axebeard6085
    @axebeard60852 жыл бұрын

    I have no idea if it is possible, but it seems to me it would be a fun FU to set up a biometric lock that wipes the machine instead of unlocking it.

  • @cleitonfelipe2092

    @cleitonfelipe2092

    2 жыл бұрын

    That's a good idea if you can implement.

  • @axebeard6085

    @axebeard6085

    2 жыл бұрын

    @Boy George if you're going to the trouble of setting up a finger-scanner wipe, then chances are opsec is more important to you than accidental data loss. And you could probably mitigate that problem by making a bi- or tri-fold wallet/checkbook case so that you don't accidentally touch that scanner while handling the phone. Or some kind of metal slipcase.

  • @cleitonfelipe2092

    @cleitonfelipe2092

    2 жыл бұрын

    @Boy George Just don't accidentally scan your thumb

  • @JocularJack
    @JocularJack Жыл бұрын

    I feel like I am on a list just for watching this, but I follow Barely Sociable and find his series on DNM's fascinating, so when I saw this video I couldn't resist clicking 😅

  • @Tarik360
    @Tarik3602 жыл бұрын

    Thanks for the upload! Very cool!

  • @flyback_driver
    @flyback_driver Жыл бұрын

    When I was in the military I had a friend of friend in psyops and they frequently handle material that cannot be lost. He taught me in a pinch you can take a handful of misc papers as well as the one you do not want seen and throw them in the kitchen sink. If you have alcohol or acetone dump it on top to bleed the ink and then run water on it. This is obviously a last ditch effort method but I feel like it applies here. Also, for secret documents and above shredding is not allowed. We exclusively burn documents like that because the army does not consider a shredded document destroyed.

  • @tommyshaw2420
    @tommyshaw2420 Жыл бұрын

    Rule 11. - "Dont tell anyone about your darknet activity".............This is a must, I had a DEA agent tell me one time that if you sell or deal in drugs, every single person who you tell what you are up to( like a friend etc) you are 20% more likely to get caught, therefore if you told 5 people you are 100% guaranteed to get caught.

  • @SouthPeter98

    @SouthPeter98

    9 ай бұрын

    5 sequential increments of 20% is 67%, but good adage

  • @michaelangelo0305

    @michaelangelo0305

    8 ай бұрын

    @@SouthPeter98 hows that

  • @stigcc

    @stigcc

    4 ай бұрын

    @@michaelangelo0305The probability that none of the five rats you out is 0.8^5=0.33. The probability that at least one of them do is 1-0.33=0.67

  • @michaelstark9988

    @michaelstark9988

    19 күн бұрын

    @@michaelangelo0305 idk how they got 67% but the probably after telling 5 people in that circumstance would entirely depend on how likely it was to happen before the first person you told. In truth, following the DEA officers logic, then after telling 5 people it would be 2.48832 times more likely than it was before you told anyone at all.

  • @roboticbrain2027
    @roboticbrain20272 жыл бұрын

    The reasoning behind a separate laptop comes from a real concern about firmware level viruses. At least theoretically it is possible to persistently compromise a device in a way which is undetectable by the running OS. There have been numerous research papers about it. However if that happens, I'm not sure if Tor etc. would do you any good anyways.

  • @rpm10k.
    @rpm10k.2 жыл бұрын

    Love your videos outlaw!

  • @animepussy8356

    @animepussy8356

    2 жыл бұрын

    MEEOOWW

  • @GaryCameron780
    @GaryCameron7802 жыл бұрын

    Should law enforcement start asking questions your best option is, "I'm not going to answer that" or "I wish to remain silent." If you're in a jurisdiction where the 5th Amendment or equivalent exists I suggest using it.

  • @tygecafe9070

    @tygecafe9070

    Жыл бұрын

    kinda makes you suspicous, i suggest do both lying and remaining silent.

  • @njpme

    @njpme

    Жыл бұрын

    @@tygecafe9070 innocent until proven guilty.

  • @d3stinYwOw

    @d3stinYwOw

    Жыл бұрын

    @@njpme Not in this world dude ;)

  • @KManAbout

    @KManAbout

    Жыл бұрын

    You shouldn't lie because that's a crime. Don't lie and there's nothing they can do. Being suspicious ain't a crime. There's too many suspicious people out there

  • @cipsone3595

    @cipsone3595

    Жыл бұрын

    @@KManAboutThat's true! Being suspicious only leads to assumptions not hard proven evidence. So don't lie (if you don't want extra in court) and don't talk to pigs

  • @nexusyang4832
    @nexusyang48322 жыл бұрын

    You can also password bind the hard drive or ssd through the bios. Once that is done, you can encrypt the drive with hardware/software encryption. To get even nuttier, you can keep a separate encrypted volume that is stored within said volume. I think truecrypt (not sure if that is still around) but they used to offer a false encrypted volume that “looks” real but there is a hidden encrypted partition within it. Kinda trippy.

  • @uniquegod1997

    @uniquegod1997

    Жыл бұрын

    veracrypt, best encryption Software out there, yep

  • @Sammysosa3
    @Sammysosa32 жыл бұрын

    Great Video. I had never thought of the possibility of using an antenna to connect to public Wi-Fi from range. That is very cool!

  • @stigcc

    @stigcc

    4 ай бұрын

    If they know you are connecting to a public wifi, they will find you, I guess. But, if you use Tails, then they would never see your IP?

  • @AriannaEuryaleMusic
    @AriannaEuryaleMusic2 жыл бұрын

    Awesome. I love all this OPSEC stuff

  • @privateassman8839
    @privateassman8839 Жыл бұрын

    On the topic of privacy screens, there's a way to modify a polarizing filter (by phisically damaging the screen), then attaching a similar filter to a pair of glasses. Basically, only someone wearing the glasses can see what's on the screen. To everyone else, it appears white.

  • @Seeks__

    @Seeks__

    Жыл бұрын

    "phisically"

  • @johnnylove2073

    @johnnylove2073

    Жыл бұрын

    ​@@Seeks__ his name is "Private Assman"

  • @Seeks__

    @Seeks__

    Жыл бұрын

    @@johnnylove2073 And you're Captain Obvious.

  • @johnnylove2073

    @johnnylove2073

    Жыл бұрын

    @@Seeks__ put a loaded Glock in your mouth and do the Lord's work

  • @sebastiangarcia-yb5ro

    @sebastiangarcia-yb5ro

    10 ай бұрын

    things like that attract attention from a passerby, private yes, eye opening or head scratching yes as well

  • @dumkastriker
    @dumkastriker2 жыл бұрын

    okay my dude, your thumbnail game is lvling up with all them waifus, I can't stop CLICKING

  • @ruperterskin2117
    @ruperterskin2117 Жыл бұрын

    Right on. Thanks for sharing.

  • @dannys9074
    @dannys90742 жыл бұрын

    Great content brother. Thanks

  • @garchamp9844
    @garchamp98442 жыл бұрын

    Is booting Tails from your normal everyday driver laptop safe? In terms of darknet opsec of course. Can the glow-in-the-dark Windows installation on the laptops internal drive see what you are doing in any way?

  • @TheGoodChap
    @TheGoodChap2 жыл бұрын

    Idk if you've seen domas's lectures on hardware CPU backdoors and undocumented instructions but I think it's extremely interesting and am not even sure just how much it could affect but its sort of a big deal

  • @crackheadgamer9880
    @crackheadgamer98802 жыл бұрын

    love your videos keep up the quality content

  • @Tobi_Jones
    @Tobi_Jones2 жыл бұрын

    great video, learned a lot, thanks

  • @MirajMusicUSA
    @MirajMusicUSA2 жыл бұрын

    No joke. You have the best channel on KZread.

  • @tjmbv8680
    @tjmbv86802 жыл бұрын

    I wouldn't update daily but weekly unless its a critical security patch, the reason being to give updates some time to make sure they are fully secure and don't have an obvious security venerability

  • @mikhailsharon4331
    @mikhailsharon43312 жыл бұрын

    This man is making the world a more secure place.

  • @ergosum5260
    @ergosum5260 Жыл бұрын

    My dig sometimes keepees on my rugs. Very informative.

  • @dht7377
    @dht73772 жыл бұрын

    Love these type of videos. Huge inspiration for doing drugs and creditcard scams

  • @yourmomgay874

    @yourmomgay874

    2 жыл бұрын

    His videos inspire me to go boating.

  • @truerandomchannel

    @truerandomchannel

    2 жыл бұрын

    @@yourmomgay874 don't forget your thumb-drive with your crypto wallet on it!

  • @foxtailedcritter
    @foxtailedcritter2 жыл бұрын

    I

  • @truerandomchannel

    @truerandomchannel

    2 жыл бұрын

    he is on odysee

  • @amogus7

    @amogus7

    2 жыл бұрын

    odysee

  • @jtreg

    @jtreg

    Жыл бұрын

    use a spelling checker

  • @beagleonvodka

    @beagleonvodka

    Жыл бұрын

    Am getting really tired of YT censorship, it's like Googles little bitch caught up in a polygamous love triangle with Zucks metaverse.

  • @dogfacezombie

    @dogfacezombie

    Жыл бұрын

    Fr

  • @naesone2653
    @naesone26532 жыл бұрын

    Love the videos keep it up

  • @funnifurrytechgirl
    @funnifurrytechgirl Жыл бұрын

    This guy is the reason I installed Gentoo, and I'm currently loving it.

  • @mr.cauliflower3536
    @mr.cauliflower35362 жыл бұрын

    I think the amount of people stealing pendrives with bitcoin wallets will increase as time goes on.

  • @randommarkonfilms3979
    @randommarkonfilms39792 жыл бұрын

    Actually too you wanna unplug power from the computer after using TAILS. Technically keys may still be extractable for a bit. Also any computer with Intel ME or AMD PSP are other attack surfaces to be aware of.

  • @sigbauer9782
    @sigbauer97826 ай бұрын

    Just want to reiterate something you mentioned towards the end of the video... The courts can force you to provide biometric data to unlock a device, but they CANNOT force you to provide any passwords. This has been settled in many systems, up to the SCOTUS (iirc). My personal phone's power button is set to go into "lockdown" mode, so if I do run into issues with the 5-0, then I can quickly lock the damn thing.

  • @poprawa
    @poprawa2 жыл бұрын

    Separating hardware is proper way to go as if main and darknet machines are on in the same time there is no way to proof remotely by correlation, that one fingerprint is always off when second one is on. When working on years of aggregated data this method can really precisely point who owns what

  • @poprawa

    @poprawa

    2 жыл бұрын

    live cd first off when second on, and vM first on when second on and second disconnects before first does. It is not about who to hack, but who to raid

  • @user-vn9ld2ce1s
    @user-vn9ld2ce1s2 жыл бұрын

    I have no idea why i'm watching this. No plans to do any illegal activity, unless our state falls into totality (again lol). It's just interesting, i guess

  • @reconstructedrichard208

    @reconstructedrichard208

    2 жыл бұрын

    yeah me either, its just really interesting

  • @jairomanzano894
    @jairomanzano8942 жыл бұрын

    great info i love info! subbed

  • @cdgonepotatoes4219
    @cdgonepotatoes42199 ай бұрын

    I'm never gonna need all this, but always good to know

  • @paultidwell8799
    @paultidwell8799 Жыл бұрын

    Necrobump. Never stop making videos kenny.

  • @rldp
    @rldp2 жыл бұрын

    Whonix is theoretically more secure than Tails. Because Whonix uses a separate virtual machine for routing all traffic to tor (gateway) even if you fuck up and infect your workstation VM, it is near impossible to get your real ip without also infecting gateway vm. Also it has more built-in anonymization tools and techniques.

  • @alexdelarge9425

    @alexdelarge9425

    2 жыл бұрын

    The only advantage Whonix has over Tails is malware protection.

  • @kim-hendrikmerk4163

    @kim-hendrikmerk4163

    2 жыл бұрын

    To attack a Tails machine you would need either root access to Tails it slef or BIOS acess to the host computer. There is no way to access the internet on tails without tor.

  • @serpentixx854

    @serpentixx854

    2 жыл бұрын

    Yes, but if i.e. the screen or keyboard of your host are compromised, then whonix would be indirectly compromised too. Best would be to have a Live USB with Whonix on top in VMs on a persistent storage and do not use the host at all, except for installing the hypervisor and updating the system. That way you reduce the attack surface of the host, but get the advantages of Whonix.

  • @ButWhyMe...

    @ButWhyMe...

    2 жыл бұрын

    What about Qubes?

  • @ButWhyMe...

    @ButWhyMe...

    2 жыл бұрын

    @@leeroyjenkins0 Yea, I think so too. I just hate that Qubes "requires tons of ram". I really want to try to run it with only 4 gbs of ram to test that theory.

  • @logono9414
    @logono94142 жыл бұрын

    I want to ask I know you’ve probably mentioned this in the past video somewhere but what are some things you can do on dark with her useful for every day life and legal I feel like there’s as much good as there is bad and I don’t have plans to start Silk Road 2

  • @icedout7606

    @icedout7606

    2 жыл бұрын

    The Tor project website explains how journalists and human rights activists etc use Tor to protect themselves. Some businesses and organisations such as Facebook and protonmail run hidden services so that people can access them from a country where the main service is blocked

  • @imagreatguy1250
    @imagreatguy12502 жыл бұрын

    Bro, i really love your stuff, I'm a closet Linux noob, lol, but really these videos are my reason for KZread 🙏

  • @rotteegher39
    @rotteegher39 Жыл бұрын

    6:47 about the screen polarizer. If you are technical and have some tools and know what you are doing you can peel of the polarized layer of the screen so it would show only as white screen backlight. You can buy or make specialized glasses from this peeled polarizer to polarize the light that is coming from the white monitor to see what's actually it's displaying. Others with naked eye would only see you staring at the white screen with some glasses on that would let you see the contents on the monitor.

  • @SouthPeter98

    @SouthPeter98

    9 ай бұрын

    That's super silly, immediate give-away that you're up to no good to anyone that sees the screen. Anyone can search what that is only and put the polarizing film over a normal camera and point it at you. There are only downsides with this, on top of it making you look like a creep

  • @rileybrown9045
    @rileybrown90452 жыл бұрын

    To add onto the darknet laptop angle: If you wear glasses, get a polarized pair & remove the polarizing film on the display of the laptop

  • 2 жыл бұрын

    If anyone sees you looking at a white screen for hours, they will think you are crazy

  • @tolkienfan1972

    @tolkienfan1972

    2 жыл бұрын

    Genius!

  • @hasher9360

    @hasher9360

    2 жыл бұрын

    @ or they could see the actual reflection of CP and _know_ you are crazy

  • @joey199412

    @joey199412

    2 жыл бұрын

    Any tutorial for how to do this?

  • @osurgac

    @osurgac

    2 жыл бұрын

    Old thinkpads have a privacy filter on them by default. They call it a TN panel

  • @seekingagreatperhaps6391
    @seekingagreatperhaps63912 жыл бұрын

    If I was in charge of interdiction efforts, I would put a lot of resources into the weakest leg of the darknet supply chain, the postal system. I'd be using AI to spot patterns, and I'd do a heck of a lot of random, passive scans of packages using machine learning to determine what is normal and what is not - weight/size of package, odor detectors, x-ray, and so on. And I mention this just to underscore that for all of this digital opsec, once a package is in the mail with your name on it, that's probably the biggest risk, and it is also the thing you control the least. I wouldn't bet on whether Darknet markets as a main source of non-government-approved goods will become more or less viable in the future, because they will keep building up government infrastructure around the postal service and they will strong-arm the big shipping companies the way they did a certain telecom some years ago with that room in San Francisco: they will make these companies an offer they can't refuse.

  • @Jacob-ol9ji

    @Jacob-ol9ji

    Жыл бұрын

    Ordering safely online will always be better then meeting someone on the street.

  • @scott8964
    @scott8964 Жыл бұрын

    Loved the video it was excellent Can you please do a video update on what is the best set-up needed to do hacking and pentesting in Australia eg is it still best to have 16 g ram and what is the best VPN company to use

  • @adam.k8222
    @adam.k82222 жыл бұрын

    Why do I feel like this video is only going to be available on Odysee in pretty short span of time.

  • @Solrex_the_Sun_King
    @Solrex_the_Sun_King2 жыл бұрын

    Isn’t there a way to take part of the screen off a computer and put that part on your glasses so only you can see your screen due to polarization?

  • @thefloridian8135
    @thefloridian8135 Жыл бұрын

    Initialize FDE and encrypt all your files. Also, I wonder if you use nested virtualization if you will be fine? As an example: running Ubuntu as main OS and download all security software as possible (you already know what), then run Parrot OS in a VM, then run tails inside the Parrot OS

  • @michealpearson8448
    @michealpearson84488 ай бұрын

    Cheers bro I bought some crack using these methods the other day x

  • @turtleb01
    @turtleb012 жыл бұрын

    With tails on an old thinkpad, your wipe key is pulling out the battery.

  • @v3listube
    @v3listube2 жыл бұрын

    It's been about 8 years since I looked into opsec and the same practices ar still relevant.

  • @mllhild
    @mllhild2 жыл бұрын

    Lovely to get all those infos. Thnaks

  • @dev-vince
    @dev-vince2 жыл бұрын

    Thanks! Helping me commit federal crimes!

  • @Lemonz1989
    @Lemonz1989 Жыл бұрын

    Great video ☺️ I’m not a vendor, by the way, I just worked at a package sorting center for my national postal company. I just want to point out one thing people might not be aware of. I don’t know if it’s similar in other countries, but I wouldn’t have a return address at all on the packages if I was a vendor. I’d rather the package go to waste than it leading back to me, because you are guilty of possession and possibly distribution if you are sending or have been sent mail with illegal *rugs in my country; even if the mail was intercepted before arrival. Many countries don’t accept international letters or packages with stamps on them anymore, and will reject them, and possibly open them. They might send them back to you if you have a return address, or destroy them if you don’t have a return address. In the latter case, they will probably open it first, to see if there is any identifying information on the sender inside the letter/package. If you want to send past international borders, you will need a postal code or a letter/package label and possibly a special label made for customs authorities in the receiving country before countries accept the mail. These codes are unique for each letter/package. Most of these labels are bought online in my country, and you will receive a receipt to your chosen email, and will have to pay with a card. These labels require a return address before allowing you to buy them. Even if they don’t require a return address, I’m pretty sure the police are able to connect the payment card with the unique letter/package label, if they are really insistent on finding the sender. However, if you are able to send internationally with stamps, like within the European Union, which has free movement of goods between member countries, then do that. Remember not to lick the stamps (because of DNA), and it would be advisable to only handle the letters/boxes with gloves on, because many countries have national databases of fingerprints now due to the new biometric passports (the majority of Europeans have passports). This might seem insane and tinfoil hat worthy, but these are things that CAN happen, but probably won’t if you are a small vendor. It’s worth going a bit overboard, in my opinion, when you have taken all these steps to stop tracking online, and then risk being caught because of a relatively low tech mistake when mailing things.

  • @maricelaguzman2965

    @maricelaguzman2965

    Жыл бұрын

    They use return addresses of businesses that they are not associated with.

  • @Lemonz1989

    @Lemonz1989

    Жыл бұрын

    @@maricelaguzman2965 Do they use just any random business as a return address? That would, however, still leave the problem with payment cards possibly being associated with postal labels.

  • @maricelaguzman2965

    @maricelaguzman2965

    Жыл бұрын

    @@Lemonz1989 NO LOL. Bro.... The vendors do not pay postage with their card that's in THEIR name that would be idiotic. They use crypto postage services and most likely theyt have runners that drop their packages.

  • @Lemonz1989

    @Lemonz1989

    Жыл бұрын

    @@maricelaguzman2965 Where on earth would you pay for postage with crypto? El Salvador?? It’s literally impossible in Europe, as far as I know. And it’s extremely difficult, if not illegal, to get an anonymous payment card in Europe, due to money laundering laws. And crypto isn’t anonymous either. Only Monero, of the major currencies, is completely anonymous.

  • @stigcc

    @stigcc

    4 ай бұрын

    Not sure why using regular stamps is a bad idea. If you don't leave fingerprints or DNA on them, they are not possible to track back to you.

  • @Praecantetia
    @Praecantetia2 жыл бұрын

    I would like to "download " this video to add to the revenue with yt-red but as I learned it might force KZread to reconsider if this Video should be monitized at all

  • @shinrakishitani1079
    @shinrakishitani1079 Жыл бұрын

    Even better, but riskier as you may ruin your device: Peel off the polarising filter from the screen and make sure you keep pieces you can make glasses out of, all people will see is a white screen

  • @pees
    @pees11 ай бұрын

    In order to save the URLs, you can also download a list containing something like 10k websites, then add the ones you want in some random lines and memorize the lines that u put the specific address.

  • @Hauketal
    @Hauketal2 жыл бұрын

    Don't set up a kill switch. You won't be able to use it when the flash-bang-grenade is thrown into your room. Have dead-man-switches that wipe your system as soon as you stop doing some activity for a while. Be fail safe.

  • @yuri5k
    @yuri5k2 жыл бұрын

    for tracking numbers. most tracking numbers are from predictable order of numbers. so why not just check 50k posssible IDs around yours using tor ? also for sanity, check also normal packages using tor

Келесі