“A Threshold Crossed”: Israel Is Guilty of Apartheid, Human Rights Watch Says for First Time

A major new report by Human Rights Watch says for the first time that Israel is committing crimes of apartheid and persecution in the Occupied Palestinian Territories. The international human rights group says Israeli authorities dispossessed, confined and forcibly separated Palestinians. “For years, prominent voices have warned that apartheid lurked just around the corner. But it’s very clear that that threshold has been crossed,” says Omar Shakir, Israel and Palestine director at Human Rights Watch. “It’s time for the international community to recognize the reality on the ground for what it is - apartheid and persecution - and take the steps necessary to end a situation of this gravity.”
#DemocracyNow
Democracy Now! is an independent global news hour that airs on nearly 1,400 TV and radio stations Monday through Friday. Watch our livestream 8-9AM ET: democracynow.org
Please consider supporting independent media by making a donation to Democracy Now! today: democracynow.org/donate
FOLLOW DEMOCRACY NOW! ONLINE:
KZread: / democracynow
Facebook: / democracynow
Twitter: / democracynow
Instagram: / democracynow
SoundCloud: / democracynow
iTunes: itunes.apple.com/podcast/demo...
Daily Email Digest: democracynow.org/subscribe

Пікірлер: 1 100

  • @JonROlsen
    @JonROlsen3 жыл бұрын

    The World has been screaming this for years, falling on deaf ears.

  • @simonhunter7370

    @simonhunter7370

    3 жыл бұрын

    I was just about to write the same thing. The poor Palestinians

  • @topixfromthetropix1674

    @topixfromthetropix1674

    3 жыл бұрын

    I'm retired in Thailand. We get more of the news about the apartheid behaviour of Israel here than you see in western mainstream media.

  • @JonROlsen

    @JonROlsen

    3 жыл бұрын

    @@topixfromthetropix1674 Here in the US our elected officials are obligated pledge allegiance to the State of Israel.

  • @JonROlsen

    @JonROlsen

    3 жыл бұрын

    @@topixfromthetropix1674 A friend and his wife moved there last year. How's things in Thailand?

  • @PrometheuzReturns

    @PrometheuzReturns

    3 жыл бұрын

    and then when you say anything abut israel or a jewish person in a position of power.. YOUR ANTISEMETIC!!!!

  • @grapeshot
    @grapeshot3 жыл бұрын

    Yes it is very plain to see that they are an apartheid state.

  • @meljahic3624

    @meljahic3624

    3 жыл бұрын

    They are all time apartheid established 1967.. People who suffer so much in WW II doing same to others, is just discusting..

  • @Gregorypeckory

    @Gregorypeckory

    3 жыл бұрын

    @@meljahic3624 The majority of Israelis weren't around for Hitler's crimes; most weren't even born yet. That excuse, never more than shameful moral cowardice, has completely outlived its usefulness, though I understand you're not making excuses, but rather condemning the oppression of the Palestinians. But I think it's no different than any other oppression; the perpetrators of most oppressive policies throughout history, have sometimes been in the role of oppressed by another group. The old assumption that people who have been terribly mistreated are unlikely to mistreat others thanks to the empathy their lived experience gave them, has been proven false too many times; we humans quite naturally, are actually pretty likely to pass on the ill treatment to others. It's disgusting and unacceptable, but far from surprising.

  • @Gregorypeckory

    @Gregorypeckory

    3 жыл бұрын

    @@louannwaters6691 Most of the world has been stepping up to condemn and call for an end to the horrific, deadly criminal Israeli occupation for well over 1/2 a century. It is US citizens who are far overdue for holding our murderous leaders of both major political parties accountable for the decisive roll they play of enabling the crimes of Israel. We are the ones funding the regime, and the only ones with the power to stop it.

  • @lesliestenta3084

    @lesliestenta3084

    3 жыл бұрын

    @@meljahic3624 great comment, I always thought that too .

  • @inoovator3756

    @inoovator3756

    3 жыл бұрын

    @richard kramer if there is no israel then what are you yelling about lol

  • @oghyeahoo6165
    @oghyeahoo61653 жыл бұрын

    Is the US guilty by association? While commiting it's own Crimes Against Humanity ?

  • @ogedeh

    @ogedeh

    3 жыл бұрын

    Yes indeed

  • @Rippypoo

    @Rippypoo

    3 жыл бұрын

    I would say that my country, the United States, has its own specific guilt and shame, conducting slavery and mandating de facto apartheid through Jim Crow laws since it was born. I think apartheid still exists here. Most people just won’t call it that.

  • @topixfromthetropix1674

    @topixfromthetropix1674

    3 жыл бұрын

    Guilt by association is not a legal term. It is a fallacy of logic. Just because you sit next to a petty thief in a restaurant does not make you a petty thief. The US has enabled Israel, it has financed Israel, it leaked nukes to Israel, promoted Israel,.. it has negotiated for Israel, etc. There might be collusion between the two countries and in some countries, if you aid someone in the commission of a crime, you are guilty of the same crime.

  • @oghyeahoo6165

    @oghyeahoo6165

    3 жыл бұрын

    @@topixfromthetropix1674 I never said it was a legal term Einstein. Reading is fundamental.

  • @larsbee

    @larsbee

    3 жыл бұрын

    USA guilty of genocide of the people of Yemen .... just as an for instance

  • @madpatriot4608
    @madpatriot46083 жыл бұрын

    This have been going on for decades, it's about time it's being brought forward

  • @paleggett1897

    @paleggett1897

    3 жыл бұрын

    Goniff-hood as a nation Israel is 🥴😢😔

  • @edwardroche2480

    @edwardroche2480

    3 жыл бұрын

    Been over 60 years that these people have been overlooked. The Israelis have deprived these people just as much as the Americans deprived the American Indians. It's genocide!

  • @inoovator3756

    @inoovator3756

    3 жыл бұрын

    @richard kramer that's just historically false lol

  • @natanielsteinic3589

    @natanielsteinic3589

    3 жыл бұрын

    @@edwardroche2480 Ignorant and stupid .

  • @edwardroche2480

    @edwardroche2480

    3 жыл бұрын

    @@natanielsteinic3589 enlightened and educated.

  • @ar4122
    @ar41223 жыл бұрын

    Why are they just getting around to labeling it...and when is the world going to do something about it?????. This is criminal

  • @AriesKJJ2
    @AriesKJJ23 жыл бұрын

    Desmond Tutu, Nelson Mandela and the African National Congress have been calling Israel an apartheid state for years. I guess we're suppose to say "better late than never" but it cost so much suffering and so many lives. Here's hoping this marks a new era for HRW.

  • @72marshflower15

    @72marshflower15

    3 жыл бұрын

    In capitalism, no lives matter..

  • @felixrabe

    @felixrabe

    3 жыл бұрын

    @@72marshflower15 Only a dead human is a good human. 🤖

  • @72marshflower15

    @72marshflower15

    3 жыл бұрын

    @@felixrabe ~ the borg only projected one individual nature over the collective. The true collective was the crew of the enterprise/federation, replete in diversity. AIs are not a human invention if they’re the next natural course of evolution. They can exist in places we can’t, thus most of them don’t care about us.

  • @felixrabe

    @felixrabe

    3 жыл бұрын

    @Pat M Well said.

  • @72marshflower15

    @72marshflower15

    3 жыл бұрын

    @Pat M Zionism Strikes Again!!! It’s a reich wing bent to end all life to force the second coming..

  • @aptorres01
    @aptorres013 жыл бұрын

    they crossed the line decades ago

  • @Commander-Rem
    @Commander-Rem3 жыл бұрын

    US Government will never admit they were wrong.

  • @Rippypoo

    @Rippypoo

    3 жыл бұрын

    Probably not until the American people make it do so. That is an uphill climb as long as corporations control the country and its government. I’m an American, by the way.

  • @topixfromthetropix1674

    @topixfromthetropix1674

    3 жыл бұрын

    If you google "THE PRINCIPLES OF PROPAGANDA," you will see that rule number 4 says, "BLAME: Never waiver, acknowledge no doubt, always blame, never credit the other side. Debase, defame, dehumanise."

  • @queenmommie8295

    @queenmommie8295

    3 жыл бұрын

    God will bend the knees of all mankind in the end

  • @Ablestreet

    @Ablestreet

    3 жыл бұрын

    Yes! That is the problem!

  • @valsyaranamual6853

    @valsyaranamual6853

    3 жыл бұрын

    Israel owns America!

  • @IMP3TIGO
    @IMP3TIGO3 жыл бұрын

    Oh please. Israel had been an apartheid state for years. Good for DN for reporting on this.

  • @jorger191

    @jorger191

    Жыл бұрын

    @-yosephhaddad9088

  • @SisHattie
    @SisHattie3 жыл бұрын

    Finally, finally, finally, someone is speaking out, without the worry of repraisals!!!!

  • @markherron6374
    @markherron63743 жыл бұрын

    Noam Chomsky exsploded this 30 years ago....and others.

  • @annamaedevlin1713
    @annamaedevlin17133 жыл бұрын

    America TURNS A BLIND EYE!

  • @syfaSkyl

    @syfaSkyl

    3 жыл бұрын

    That's because they themselves are blind.

  • @zyxw2024

    @zyxw2024

    3 жыл бұрын

    The UNITED STATES $$$ > Israel.

  • @dansiwek3593

    @dansiwek3593

    3 жыл бұрын

    No they don't they pay them millions upon millions to commit their crimes, Israel and America are fake criminal "countries" .

  • @zyxw2024

    @zyxw2024

    3 жыл бұрын

    There're 58 American flags. Refer to my photo. Referring the UNITED STATES as America insults/disparages all of 2 Americas nations.

  • @zyxw2024

    @zyxw2024

    3 жыл бұрын

    That's how false narrative perpetuates the false U.S. superior nationalism.

  • @tsahai1000
    @tsahai10003 жыл бұрын

    The injustice there is in the world is sickening. Every country turns the back on the reality of what is going on because it is not in their interest .

  • @phaedrussocrates7636
    @phaedrussocrates76363 жыл бұрын

    Thank you Democracy Now, this os really important!

  • @_BhagavadGita
    @_BhagavadGita3 жыл бұрын

    The racist U.S.A. was also late to recognize South Africa as an apartheid state when they were practicing it. So this not a surprised.

  • @freepalestine7687

    @freepalestine7687

    3 жыл бұрын

    I think by now everyone knows they arm Israel and so support the apartheid status with American tax money . Just watched a video of an American jew who moved into a Palestinians house...i had a hard time believing it. He literally admitted that the house didn't belong to him but if he didn't move in another one would.

  • @YTHatesMe-999

    @YTHatesMe-999

    3 жыл бұрын

    South Africa more than likely got the idea for apartheid from the US. Not to mention Israel was a staunch supporter of that regime for years.

  • @sagapoetic8990

    @sagapoetic8990

    3 жыл бұрын

    Many of us are not racist but we have been critical of anti-democratic measures and laws and have experienced harassment for it. Don't lump everyone into the same box. Those of us with ethics -- fight and we don't back down.

  • @malachytully5469

    @malachytully5469

    3 жыл бұрын

    @@YTHatesMe-999 no they got it from the British as they have been doing this for hundreds of years in each Country they Conquered around the World and the British was in charge of Palestine (Middle East) and you can look up the Balfour Agreement/Promise and you see the Walls in Palestine are very Similar or Worse to the Walls put in the North of Ireland to keep the Native Irish out of their own Land because Loyalists now Live there!

  • @pameladunigan7959

    @pameladunigan7959

    3 жыл бұрын

    They share the same values.....

  • @roywood2325
    @roywood23253 жыл бұрын

    Israel should have learned a big lesson of 1942 .Don't do onto others that you don't want done onto you.

  • @neilsarath9812

    @neilsarath9812

    3 жыл бұрын

    🤔One would think so. 🇵🇸

  • @silvyasmith4748

    @silvyasmith4748

    3 жыл бұрын

    That is a nice one 👍🏿👍👍🏼

  • @susanarupolo2212
    @susanarupolo22123 жыл бұрын

    Thank you Amy you are a great journalist. The CREATOR bless you with what you need.

  • @efeathers1307
    @efeathers13073 жыл бұрын

    When you preach that your the victim for so long, you’ll cease to recognize when you transitioned to Dictator. And at worst you’ll have a laundry list of excuse why you believe you can oppress those you deem oppressable !!

  • @Rippypoo

    @Rippypoo

    3 жыл бұрын

    Political parties opposed to one another tend toward the same thing. That’s what’s been happening in the US for a long time. Republicans have been in control for decades here while at the same time screaming that they’re the “victims” of the Democrats’ overreaching power, which does not exist. That’s one of the things that Republicans use to STAY in power.

  • @staticking1626

    @staticking1626

    3 жыл бұрын

    They cornered the market on sympathy. Then they began to take on the characteristics of their (German) oppressors - and use those same tactics on the Palestinians. Bibi should be bunkmates with Charles Taylor at the Hauge.

  • @cynthialangley7338
    @cynthialangley73383 жыл бұрын

    This is long overdue.

  • @pacerodi

    @pacerodi

    3 жыл бұрын

    Way too long.

  • @demetriusevans1173
    @demetriusevans11733 жыл бұрын

    Of course. They've become what they once stood against. The bullied became the bully.

  • @NoMad42
    @NoMad423 жыл бұрын

    Thank you! At last... it says a lot about a nation, that seems to have forgotten their own times of struggle, and instead of trying to make a difference, they choose to treat others with the same disregard and contempt. The world was blind to this issue for too long.

  • @AudioPervert1

    @AudioPervert1

    3 жыл бұрын

    Why just Israel ?? (Which is a rotten neo-nazi tribal state anyways). Even Google and Google Maps apply the same apartheid about Palestine. If one searches "Palestine" on Google Maps. Nothing shows up. dispossessed and erased too!

  • @paulspacey346

    @paulspacey346

    3 жыл бұрын

    @@AudioPervert1 I think the answer lies in who is in charge of Google and/or what connections those that support the supremacist state of Israel have at Google...the Zionists and their supporters are hard at work behind the scenes to have decisions made that protects their colonial enterprise...like the definition of what anti-semitism is and getting states in the US to oppose BDS etc etc

  • @wavelength7503

    @wavelength7503

    3 жыл бұрын

    @@AudioPervert1 google is American corporations. As is the history told on Wikipedia. Will you see on Google map of the lands of the native "Americans". This is why Israel agree with USA, as does USA agree with Israel.

  • @queenmommie8295

    @queenmommie8295

    3 жыл бұрын

    You speak of the way that ish has been treated what about the copper colored indigenous aboriginal natives in america? Thay have been and are still under a Holocaust and genocide against them. Give all praise to the God of the heavens and the earth.

  • @wavelength7503

    @wavelength7503

    3 жыл бұрын

    @richard kramer and the reverse applies. All that funding goes back to support Israeli right wing groups in America like AIPAC etc etc etc.

  • @goldmother2238
    @goldmother22383 жыл бұрын

    Israel has powerful friends. Thats all it takes to get away with barbaric actions

  • @auntijen3781
    @auntijen37813 жыл бұрын

    "The arc of history is long but it bends twords justice"

  • @merbst

    @merbst

    3 жыл бұрын

    ideally!

  • @tribalypredisposed

    @tribalypredisposed

    3 жыл бұрын

    Then, why are you on the other side, fighting against the arc of history?

  • @bryna7

    @bryna7

    3 жыл бұрын

    @@tribalypredisposed who are you talking to?

  • @tribalypredisposed

    @tribalypredisposed

    3 жыл бұрын

    @@bryna7 I am talking to the poster here, and most of the other people who have posted here. Your racist hatred of Jews in the "leftist" War and Injustice camp is definitely not on the side of justice or something that history will see in a positive light. "Jewish Voices for Peace" just condemned a politician for calling for peace between Israel and the Palestinians. That group has a smaller percentage of Jews than exists in the general population, and clearly not even slightly in favor of peace.

  • @anthonytom-duyquang3558

    @anthonytom-duyquang3558

    3 жыл бұрын

    @@tribalypredisposed Saying Anti-Zionism is anti-Semitic is like saying people who are anti-CCP anti-Chinese.

  • @larsbee
    @larsbee3 жыл бұрын

    waiting for Amnesty International now to come to the same conclusion....

  • @MariaD-qf4sr
    @MariaD-qf4sr3 жыл бұрын

    Can we finally hold them accountable the way they want all to be held accountable for atrocity done to others by them? No one is above the law

  • @AmScEn
    @AmScEn3 жыл бұрын

    The once victims become the now victimizers!

  • @queenmommie8295

    @queenmommie8295

    3 жыл бұрын

    They have used this to trick the whole world into giving them all of your money, weapons and power of the world.

  • @anpdm1
    @anpdm13 жыл бұрын

    It took 30 years of research by human rights watchers to determine this is actually apartheid or it took that long to ADMIT that it is apartheid?

  • @SEmme-ov6yy
    @SEmme-ov6yy3 жыл бұрын

    I’m only going to say this: DUHHHHH

  • @kevinthomas6528
    @kevinthomas65283 жыл бұрын

    If this is the case than why is the United States not also considered an appartide state and it clearly is

  • @Rippypoo

    @Rippypoo

    3 жыл бұрын

    Totally agree. The US government has been passing de facto apartheid laws for a very long time, but nobody will call them by that name.

  • @revbogoldie2368

    @revbogoldie2368

    3 жыл бұрын

    Right on

  • @staticking1626

    @staticking1626

    3 жыл бұрын

    Tell the truth and shame the devil!!

  • @randomeventstv

    @randomeventstv

    3 жыл бұрын

    What do you mean if that’s the case do you not believe Israel is practicing APARTHEID?

  • @chesterjade7630

    @chesterjade7630

    3 жыл бұрын

    Believe me we demonstrate and doing it right now. America is a racist nation and was built on white supremacy. They came to America and displaced Native Americans and created systemic slavery and bondage for decades. America is in denial of it's racism and culture of white supremacy and terrorism. History and facts cannot erase or refute what i am saying.

  • @billymac4242
    @billymac42423 жыл бұрын

    As are the US/UK government's by holding a journalist by the name of Julian Asange in prison. BUT YOU SEEM TO HAVE FORGOTTEN HIM

  • @HillbillyHippyOG
    @HillbillyHippyOG3 жыл бұрын

    Dang, US hegemony is truly over if we’re now allowed to hear that Israel isn’t perfect without it being immediately followed by accusations of antisemitism.

  • @Rippypoo

    @Rippypoo

    3 жыл бұрын

    I’m sure that’s coming, if it already hasn’t started on Twitter.

  • @keirfarnum6811

    @keirfarnum6811

    3 жыл бұрын

    I’m sure the trolls will be along shortly.

  • @jamespurcer3730
    @jamespurcer37303 жыл бұрын

    The U.S. government will totally ignore this.

  • @themarbleking
    @themarbleking3 жыл бұрын

    Good! When are they going to acknowledge America’s segregation?

  • @PapiElric
    @PapiElric3 жыл бұрын

    Thank you from France.

  • @CAL-jj4om
    @CAL-jj4om3 жыл бұрын

    Saying we don't agree about violence against Palistinians is like saying police aren't more violent against black men, women & children.

  • @silvyasmith4748

    @silvyasmith4748

    3 жыл бұрын

    100%👍🏿👍👍🏼

  • @bertramdavis7120
    @bertramdavis71203 жыл бұрын

    Sad we are dealing with this , when we should be holding one another up. But hate is real!

  • @tribalypredisposed

    @tribalypredisposed

    3 жыл бұрын

    Yes, and hate is what "Human Rights Watch" and "Democracy Now" are peddling here.

  • @Patrick.Edgar.Regini
    @Patrick.Edgar.Regini3 жыл бұрын

    Outrageous! What can one say about the United States! ... unspeakable words.

  • @ur22much2
    @ur22much23 жыл бұрын

    Looks like a good example of the persecuted becoming the persecutors, the abused becoming the abusers.

  • @angiealexis3717
    @angiealexis37173 жыл бұрын

    I've been saying that forever! What they did to the Palestinians is similar to what the Nazi's did to their families!

  • @selaskiss
    @selaskiss3 жыл бұрын

    What is hidden in the dark comes to light!

  • @timothysmith4260
    @timothysmith42603 жыл бұрын

    They forgot about apartheid in The United States as well.

  • @evelyneeliana8254
    @evelyneeliana82543 жыл бұрын

    2021 humanity is still fucked up with the need of power, money and domination.

  • @pacerodi
    @pacerodi3 жыл бұрын

    Long live the soul of Steven Biko!

  • @mirzoalim
    @mirzoalim3 жыл бұрын

    21 st century however some country lives similar Nazi style.

  • @BenGrem917

    @BenGrem917

    3 жыл бұрын

    @Men In Black That's an interesting point.

  • @silvyasmith4748
    @silvyasmith47483 жыл бұрын

    One day one day time will come for Palestinians rights 👍🏿👍👍🏽

  • @clarenceedwards2866
    @clarenceedwards28663 жыл бұрын

    I have one question: what took you all so long?

  • @stanleydorsey2884
    @stanleydorsey28843 жыл бұрын

    The bringing up Apartheid is not done lightly to be dismissed in one sentence. I worry that the United States may adopt Israel's policies.

  • @inoovator3756

    @inoovator3756

    3 жыл бұрын

    @Maria Dowler yes no one in history ever put their knee on someone neck until israel started it. Don't be ridiculous

  • @ralphhester2457

    @ralphhester2457

    3 жыл бұрын

    They originated the policies,they did the same to Palestinians usa did to native americans...like pot calling kettle black...

  • @inoovator3756

    @inoovator3756

    3 жыл бұрын

    @@ralphhester2457 show me an example of israel giving smallpox blankets to the Palestinians

  • @ralphhester2457

    @ralphhester2457

    3 жыл бұрын

    @@inoovator3756 you got me f*cked up innovator,never said Israel gave Palestinians small-pox blankets...sounds like something good usa would do to native americans...rush to judgement, guilty conscience or what, Israeli who's the dead guy they stampede each other worshipping?

  • @inoovator3756

    @inoovator3756

    3 жыл бұрын

    @@ralphhester2457 that is something that the US did to the natives. Youre the one that said israel is doing the same as the US so I asked you to give me an example of this and you failed to do so. So no israel is not doing the same thing

  • @PalCan
    @PalCan3 жыл бұрын

    If only the MSM would cover this story like you did. Thank you Democracy Now.

  • @auntijen3781
    @auntijen37813 жыл бұрын

    Nice to see DN on the right side (or should I say the anti propaganda side) of a pivotal global human rights issue, again.

  • @robertstan298
    @robertstan2983 жыл бұрын

    Not the biggest fan of HRW at times... but I am absolutely glad they finally got the balls to say and do this out loud.

  • @luke021380
    @luke0213803 жыл бұрын

    About time, great example of radical religious extremism gone wrong. Not the way Israelis want to spin it.

  • @susanbradleyskov9179
    @susanbradleyskov91793 жыл бұрын

    Finally! 👍

  • @positivethinker09
    @positivethinker093 жыл бұрын

    Please contact your state leaders, senators/congress/city council/etc to support this movement. Educate yourself on this issue.

  • @Linda43

    @Linda43

    3 жыл бұрын

    You are no Jew

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca3 жыл бұрын

    While many are quick to point out multiple examples of some level of recognition by human rights watch and other organisations, this still is a huge step towards public recognition of the reality of the citation. Finally an organisation with world wide recognition uses the proper terms that clearly portray the power imbalance in the region. It is not a complicated citation, it is not a case where both sides share equal or somehow undeterminable blame - it is one racial groups oppressive control and discrimination against another. It is apartheid regime over Palestinian lives, by the Israeli government and military. This is an entirely different tone than just pointing out cases of discrimination and violation of human rights. It doesn't leave room for whataboutism. It doesn't leave room for listing individual terror attacks or Palestinian organisations as a reason for such controlling of lives and opportunities of Palestinian people. None of those can defend apartheid regime. And no citation, condition or circumstance can explain violence and crimes committed while attempting to merely maintain social order and governance based on racial discrimination.

  • @MrRocketRider
    @MrRocketRider3 жыл бұрын

    Thanks for covering this

  • @pianoman9685
    @pianoman96853 жыл бұрын

    NOW DO SOMETHING ABOUT IT

  • @fazaelma
    @fazaelma3 жыл бұрын

    Minute 7:36 made me want to cry...all these nice new houses for Jewish settlers on occupied land. It is heart breaking.

  • @tracyrichard4005
    @tracyrichard40053 жыл бұрын

    2 of those definitions fit America

  • @FaustianAct6
    @FaustianAct63 жыл бұрын

    What goes around, comes around. There time will come.

  • @JohnJohnson-xe8hy
    @JohnJohnson-xe8hy3 жыл бұрын

    The time is up, scriptures is real God is preparing for the real truth

  • @stenyethanmathews945
    @stenyethanmathews9453 жыл бұрын

    How long did this take? About time.

  • @fredgagger375
    @fredgagger3753 жыл бұрын

    There is no valid reason for someone to dislike this video.

  • @felixrabe

    @felixrabe

    3 жыл бұрын

    I sometimes wish there were more nuanced ways to give feedback. Do I "like" a video because of its content? (I liked this one because some maybe-relevant org finally calls apartheid apartheid.) Do I "like" a video because it is important? Do I "like" a video because it is well done / high production value, (almost) a piece of art? Do I "like" a video because it helped me gain a new perspective?

  • @felixrabe

    @felixrabe

    3 жыл бұрын

    ... So ... I could see someone giving this video a "dislike" because they don't like the fact that Palestinians are suffering.

  • @felixrabe

    @felixrabe

    3 жыл бұрын

    Oh and btw, the video starting at 1:02 would get a very hesitant "like" from me, only for the content and maybe for the production, but boy does it come across as tone-deaf. It is presented in an upbeat manner as if apartheid was a GOOD thing!

  • @rogermcintosh944

    @rogermcintosh944

    3 жыл бұрын

    What kind of logic believes that they have a right to take land from some one and control their lives.

  • @felixrabe

    @felixrabe

    3 жыл бұрын

    @@rogermcintosh944 Maybe, patho-logic?

  • @MarkSmith-yk7ig
    @MarkSmith-yk7ig2 жыл бұрын

    Its time to bring Israel to court. !!!

  • @robertstan298
    @robertstan2983 жыл бұрын

    The brutal history of colonialism never ends...

  • @br5448
    @br54483 жыл бұрын

    thank you, Human Rights Watch. So important. My question - how many other nations also qualify??? Not to take away from the analysis of Israel.

  • @IMP3TIGO

    @IMP3TIGO

    3 жыл бұрын

    No other developed nation for sure.

  • @marciamakesmusic

    @marciamakesmusic

    3 жыл бұрын

    @@IMP3TIGO yeah it's not like the US has concentration camps or anything

  • @marwanmarz9851

    @marwanmarz9851

    3 жыл бұрын

    None. No other nation have been at it this long or this brutal/systematic. Israel stands alone as the worst criminal apartheid abomination

  • @IMP3TIGO

    @IMP3TIGO

    3 жыл бұрын

    @@marciamakesmusic that's a ridiculous attempt at false equivalence.

  • @shamsheerg7519

    @shamsheerg7519

    3 жыл бұрын

    @@marwanmarz9851 What about Shai's in Sunni countries? This conflict has been happening for 1400 years... Do you remember this?

  • @gabriellekarlic7536
    @gabriellekarlic75363 жыл бұрын

    Karma can be instant

  • @johnallenbailey1103
    @johnallenbailey11033 жыл бұрын

    I've never heard the US called an apartheid state but thats wtf it is...

  • @edzukich
    @edzukich Жыл бұрын

    THANK YOU IRELAND FOR YOUR SUPPORT AND HUMANITY

  • @larsbee
    @larsbee3 жыл бұрын

    I think we have apartheid in the US of Amnesia! .... gasp...

  • @mildredmartinez8843
    @mildredmartinez88433 жыл бұрын

    Amy, thank you for reporting what commercial news does not. This is heartbreaking what is happening to Palestinians. Israel gets away with this because they are backed by the big godfather. Inhumane and shameful.

  • @jeffsartadventure3634
    @jeffsartadventure36343 жыл бұрын

    Let's all hold our breath until sanctions are placed on the regime..

  • @Olivia-ge1oz
    @Olivia-ge1oz3 жыл бұрын

    FREE MY FAMILY AND MY PEOPLE IN PALESTINE NOW!!

  • @adropofgoldensun27
    @adropofgoldensun273 жыл бұрын

    “don’t worry about American pressure, we the Jewish people control America.” - Israeli Prime Minister Ariel Sharon

  • @jurgenjung4302

    @jurgenjung4302

    Жыл бұрын

    Stimmt. Die Bankenmafia ist in den Händen der Rothschild's.

  • @victornoyan2578
    @victornoyan25783 жыл бұрын

    Judgement on lsriel

  • @adacasas511
    @adacasas5113 жыл бұрын

    The Path of Justice is the same as the path of Injustice. However the direction is what determines your destination.

  • @matthewuldriks2806
    @matthewuldriks2806 Жыл бұрын

    Human rights and justice ⚖️ for all.

  • @lawrenceholst3808
    @lawrenceholst38083 жыл бұрын

    If you show no shame do as you wish; wait until god grabs a hold of you.

  • @bingus3582
    @bingus35823 жыл бұрын

    Yet no sanctions on Isreal

  • @neilsarath9812

    @neilsarath9812

    3 жыл бұрын

    Is there ever.

  • @ganstagansta668
    @ganstagansta6683 жыл бұрын

    So is America.

  • @wolfsheepclothing
    @wolfsheepclothingАй бұрын

    What a joke…FOR THE FIRST TIME? Where were they for the past 75 yrs?

  • @alanhynd7886
    @alanhynd78863 жыл бұрын

    Excellent report, would it be possible to have a similar one on the rapidly diminishing number of Christians in the Middle East in general and from Gaza in particular?

  • @gilangthehuman7713

    @gilangthehuman7713

    3 жыл бұрын

    Probably moving to western countries

  • @azariazr12
    @azariazr123 жыл бұрын

    🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥

  • @lawrenceholst3808
    @lawrenceholst38083 жыл бұрын

    Oppression is worse than killing

  • @asmahamidullah9571
    @asmahamidullah95713 жыл бұрын

    It is about time! 😡😡😡

  • @creekwalker62
    @creekwalker623 жыл бұрын

    I reckon 'God's Chosen People' learned first hand how to oppress from the Nazi's.

  • @ralphhester2457

    @ralphhester2457

    3 жыл бұрын

    It's in the DNA...

  • @denisbaribeau509
    @denisbaribeau5093 жыл бұрын

    Sound a lot like the USA

  • @aminahujale1049
    @aminahujale10493 жыл бұрын

    I appreciate this platform for airing the truth. Palestine must be freed from the israeli apartheid.

  • @lulac4933
    @lulac49333 жыл бұрын

    They can't be the chosen seed of Abraham,Issac and Jacob

  • @cheshired.catastrophe86
    @cheshired.catastrophe863 жыл бұрын

    The us government doesn't wat to accept it for the same reason Canada won't ad that's because the definition that's been put forth DIRETLY correlates with their continued treatment of Native American occupied territories.

  • @gan5045

    @gan5045

    3 жыл бұрын

    It's more than that ... but YES! nailed it! Food for thought, Mossad had it's fingerprints all over 9 eleven. Partners in crime since WW2!

  • @jenniferr9624

    @jenniferr9624

    3 жыл бұрын

    Exactly.

  • @river13
    @river133 жыл бұрын

    We should be paying attention and taking care of our own atrocities before we throw stones.

  • @adamblackman6660

    @adamblackman6660

    3 жыл бұрын

    We’re participating, by selling them arms.

  • @Fafnd

    @Fafnd

    3 жыл бұрын

    We can chew bubble gum and walk at the same time.

  • @river13

    @river13

    3 жыл бұрын

    @@Fafnd The atrocities started a long time ago so evidently not.

  • @tesso.6193

    @tesso.6193

    3 жыл бұрын

    and one of your atrocities is handing over billions in aid to these monsters. And being the one country to veto sanctions against it for decades. That's all it would it take. Just stop actively assisting Israel.

  • @ohwyywy1532
    @ohwyywy15323 жыл бұрын

    about time!!!

  • @AndyStone13
    @AndyStone133 жыл бұрын

    Imagine the response and outcry from Western Countries if you replaced 🇮🇱 with 🇨🇳 or 🇷🇺

  • @awareyah6146
    @awareyah61463 жыл бұрын

    The Bible says that the REAL Holy Land is desolate 🤔

  • @awareyah6146

    @awareyah6146

    3 жыл бұрын

    Meaning NO ONE occupies the land

  • @eevve9894

    @eevve9894

    3 жыл бұрын

    It's about evil politicians, they could use any reason to do what they do, so reasons are not important.

  • @GladysAlicea

    @GladysAlicea

    3 жыл бұрын

    Scripture says that most Jewish Israelis won't get into heaven. God is well aware of His "chosen people's" shortcomings, lies and hypocrisy.

  • @marwanmarz9851

    @marwanmarz9851

    3 жыл бұрын

    If you're going to follow the bible, God cursed and exiled the jews, ensured His house and ark are gone and forbade the return of jews or re establishment of Israel.

  • @inoovator3756

    @inoovator3756

    3 жыл бұрын

    @@marwanmarz9851 actually the Quran says that the jews would return to israel. Israel is simply the will of God

  • @sher3571
    @sher35713 жыл бұрын

    GOD Is Watching

  • @Linda43

    @Linda43

    3 жыл бұрын

    The return to Zion,the in gathering of the exiles, and the reclamation of the land of Israel are all G-ds will and a fulfillment of his eternal covenant with the Jewish people

  • @drh4571

    @drh4571

    3 жыл бұрын

    Is he?

  • @sher3571

    @sher3571

    3 жыл бұрын

    @@drh4571 I Am

  • @fifteenbyfive
    @fifteenbyfive3 жыл бұрын

    Thanks Democracy Now! for standing up for basic human rights of oppressed people such as Native Americans and Palestinians. Thanks Omar Shakir.

  • @aprilk141
    @aprilk1413 жыл бұрын

    I think its important to point out the distinction between Israeli government and it's citizen's and government antimuslim propaganda.

  • @tobeme4054
    @tobeme40543 жыл бұрын

    America has done horrible things to black people but my comments are being removed?

  • @psygnale
    @psygnale3 жыл бұрын

    ...well... that only took about seventy years...

  • @belkyhernandez8281
    @belkyhernandez82813 жыл бұрын

    Shared.

  • @playstation9435
    @playstation94353 жыл бұрын

    Thank you

Келесі